Dems Associated with Epstein Disrupts TDS Trump-Linked Hoax


John R. Houk, Blog Editor

© November 18, 2025

The Dems (who today have gone full Marxism) so fear losing Deep State control they have contrived a host of hoaxes to frame President Trump. Trump Derangement Syndrome (TDS) is an infection among Dems, RINOs & Leftists in general so severe they propagandize twisted information as if it’s truth. A TDS agenda that has failed multiple times since 2016. The Latest: The Epstein Hoax.

It has been proven this latest hoax is based on selective unrelated and suspiciously redacted emails (in some cases even altered) to cast mud on President Trump hoping in full TDS mode it sticks. As in the past – IT WILL NOT STICK!

Hilariously, part of the Epstein Hoax unraveling pertaining to President Trump is Trump is shooting back at the Dems with his own Epstein finger-pointing. The President is releasing and investigating Dems that actually consorted with Epstein crimes. As the Dem list of sex-deviants and pedophiles gets longer, begin to wonder the reason behind the Dems becoming tight-lipped toward Epstein and false claims of any Trump association.

One Dem-darling is Larry Summers. Read about the Summers association to Epstein:

Unless you are a Dem, you might not know the name Summers (former Treasury Secretary and Harvard professor). Here is a crooked Dem Couple all should know NOW being implicated with Epstein: Bill & Hillary (or is it killary?) Clinton.

WND ran a news piece that the Crooked Clintons are refusing to testify in a Congressional summons in relation to Epstein. Hmm… I believe we can guess why.

JRH 11/18/25

ALWAYS FREE TO READ yet READER SUPPORTED!

PLEASE! I need more Patriots to step up. I need Readers to chip in $5 – $10 – $25 – $50 – $100 (PAYPAL or CARD – one-time or recurring). YOUR generosity is APPRECIATED. PLEASE GIVE to Help me be a voice for Liberty:

Please Support CPCR

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

Our Senior Citizen Family Supplements our income by offering healthy coffee products. BETTER YOUR HEALTH with healthy & good tasting COFFEE and enjoy some weight management supplements. BUY Happy Coffee & Weight Loss Supplements at the Diana Wellness Store: https://dianawellnessstore.com  

>>SHOP TAB<<

READ THE REST AT JOHN’S NEWSLETTER!

Trump & MAGA Need to Re-Find Common Ground or it WILL Be Bad for America’s Future


John R. Houk, Blog Editor

© July 16, 2025

I’ve noticed on Social Media platforms President Trump’s primary electoral MAGA base is EXTREMELY upset over the Administration’s decision to NOT pursue Epstein pedophile & sex trafficking Elitists accountable. When I first became aware of this decision, I TOO was upset.

Frankly it us a good thing for MAGA Joe-Americans to send a STRONG voice of disapproval toward President Trump. Essentially Trump is constitutionally a lame duck President not able to run for POTUS any longer. So, he might feel he can squeeze policy decisions that displease his base.

HOWEVER, If Trump wants to accomplish future policies with Congressional support, the President should begin recalculating about what UPSETS his base and what EXCITES his base. OR President Trump might again be facing idiot false Impeachment proceedings between 2026 and 2028.

BECAUSE you can count on wicked Dem-Marxist Traitors exploiting MAGA division to re-take the majority in Congress to stop the MAKE AMERICA GREAT AGAIN agenda and set the stage for the return of tyranny AGAINST Dissenters fighting the fundamental transformation of America.

Frankly Trump screwed up! There are all kinds of Conspiracy Theories being advanced trying to make sense on Trump’s Epstein reversal. AND those theories all point to a compromised Trump in the eyes of MAGA.

So if President Trump plans for any more success in his last term of Office, Trump needs to make some HUGE concessions on the Epstein issue. EVEN IF those concessions bruise his ego. It is better to wipe a little egg off his face rather than becoming an abject failure in delivering future positive MAGA accomplishments.

If Trump responds with conciliatory concessions then FOR GOD’S SAKE and AMERICA’s SAKE, MAGA people need to recognize the concessions rather than smear more eggs in Trump’s face. For if MAGA refuses the concessions, get ready for a future of Dem gulags and reeducation camps.

A couple of July 14 posts I believe could point toward a potential MAGA-American future if Trump and MAGA fail to make peace by November 2026:

JRH 7/16/25

READER SUPPORTED!

PLEASE! I need more Patriots to step up. I need Readers to chip in $5 – $10 – $25 – $50 – $100 (PAYPAL – one-time or recurring). YOUR generosity is APPRECIATED. PLEASE GIVE to Help me be a voice for Liberty:

Please Support CPCR

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

Our Senior Citizen Family Supplements our income by offering healthy coffee products. BETTER YOUR HEALTH with healthy & good tasting COFFEE and enjoy some weight management supplements. BUY Happy Coffee & Weight Loss Supplements at the Diana Wellness Store (provide a valid email & phone number with order or the Company Store might suspect fraud): https://dianawellnessstore.com

>>HAPPY HEALTHY COFFEE & PERFORMANCE DUO MUSCLE GROWTH & DEFINITION<<

****************************

SECRET EXPOSED – Democrat’s Plan To Win The Next Election – Video

Final Word: It is a sad day when all the Democrats have is hate, disaster, and ruin to preach! How about a message of hope!

USA Depression Era (CFP Photo)

By Steve Eichler

July 14, 2025

Canada Free Press

What is the Democrats plan to win the next election? Is their plan to build American farmers, or perhaps to help families and small businesses? Should the Democrats push the progressive agenda or build on diversity, inclusion, and equity, or perhaps climate change? Instead, the progressive Dems are pushing for a total economic meltdown, destroying small businesses, families, and retirement accounts so they can be reelected!

Youtube SHORT: Democratic Insider’s Shocking Confession: Praying for Economic Downturn?

[By @NewsinaMinute-be8oq

Posted on 7/14/25]

How many families will be shattered if the Democrats install their election economic disaster plan?

They know diversity, inclusion, and equity, along with climate change, are non-starters, and the voting public rejects their alarmist disaster calls. The public is tired of hearing wolf, wolf and wants to see results.

Is the Democrat Party really rooting for America’s financial ruin? Yes. And this is the rest of the story.

In a startling admission that should alarm every working American, insiders close to the Democrat Party are now openly confessing what many have suspected all along: they would rather see citizens lose their jobs, their savings, and their future than see their political fortunes decline any further.

According to a report from The Hill, Democrat strategists, faced with record-low approval ratings and no credible national leader, are so desperate to regain relevance that they are praying for an economic depression. One strategist flatly admitted, “We better pray long and hard that the country is going to be in a f—ing depression, because I don’t know how else we find ourselves out of this mess.”

Take a moment and think about what that means. These are not fringe activists. These are the so-called “professionals” running a major American political party. And rather than trying to fix their own broken message, rather than caring about whether citizens can pay their mortgage, afford groceries, or keep their 401(k) afloat, they are openly fantasizing about a historic economic collapse.

Why? Because the suffering of millions would give them a pretext to grab more power and ram through their vision of a top-down, government-controlled utopia.

This is not a conspiracy theory or tin-foil-hat blather; it is their own words.

Their calculus is simple:

  • A thriving economy makes it harder to sell radical policies.
  • A depression creates panic, and anxiety makes people willing to surrender freedom for false promises of security.
  • If Wall Street tumbles, if retirees see their pensions obliterated, if small businesses shut down, Democrats believe they can finally convince America that the only solution is more centralized control, the very same failed socialist policies that have devastated nations from Venezuela to the Soviet Union.

It’s no wonder Democrat messaging has become a confused, bitter mess. Even liberal billionaires like Mark Cuban are disgusted. As Cuban bluntly put it, “It’s just ‘Trump sucks.’” There is no vision, no plan, only resentment, grievance, and a desire to see America punished for rejecting them at the ballot box.

After President Trump’s 2024 victory, Democrats promised they would regroup, rethink, and reconnect with voters. Instead, they’ve doubled down on elitist contempt. A recent poll by the Democrat super PAC Unite the Country found that voters see the party as “out of touch,” “weak,” and “woke.” When Rahm Emanuel, hardly a conservative, warns that Democrats are less popular than Elon Musk, it’s clear their crisis runs deeper than a single election loss.

But rather than facing reality, Democrat operatives are now hoping economic disaster will bail them out. Let’s be clear: these are not the actions of a party interested in serving working Americans. These are the actions of a movement determined to seize power at any cost, even if it means economic ruin.

If the last few years have taught us anything, it’s that nothing is too extreme for ideologues convinced they know what’s best for everyone else. Whether it’s lockdowns, censorship, or now cheering for an economic meltdown, the radical wing of the Democrat Party will do whatever it takes to force their agenda on the country.

Americans deserve leaders who want to see them succeed, not leaders who see the middle class’s financial pain as a political opportunity. The Democrats’ breathtaking willingness to root for depression should be a wake-up call. When a party is so desperate for power that it wants to manufacture a crisis, it has lost any claim to moral authority and any claim to be trusted with America’s future.

Final Word: It is a sad day when all the Democrats have is hate, disaster, and ruin to preach! How about a message of hope!

Patriot Command Center

Steve Eichler is the Founder of PatriotCommandCenter.org, a retired attorney, active member of the International Bar Association. He served as the Executive Director of the Minuteman Project, which raised national awareness about illegal immigration. He is also a Co-Founder of the Tea Party movement and the Founder and President of the Tea Party PAC, a Super Political Action Committee. Additionally, Mr. Eichler is a Reserve Member of the Israel Defense Forces (IDF).
For more information, visit: https://patriotcommandcenter.org/members/SteveEichler

Content is Copyright 1997-2025–the individual authors | Site Copyright 1997-2025 Canada Free Press

+++++++++++++++++++

Jude Foretells Our Time

By Terry James

July 14, 2025

Terry James Prophecy Line

We look around at the insanity that seemingly dominates culture and society and ask: “Has the world gone completely mad?” The Bible has the answer, of course. Paul the great apostle, for example, gives an answer:

And even as they did not like to retain God in their knowledge, God gave them over to a reprobate mind, to do those things which are not convenient; Being filled with all unrighteousness, fornication, wickedness, covetousness, maliciousness; full of envy, murder, debate, deceit, malignity; whisperers, Backbiters, haters of God, despiteful, proud, boasters, inventors of evil things, disobedient to parents, Without understanding, covenant breakers, without natural affection, implacable, unmerciful: Who knowing the judgment of God, that they which commit such things are worthy of death, not only do the same, but have pleasure in them that do them. (Romans 1:29–32)

We are in the middle of a generation that embraces evil, as we have looked at many times. I’ve proposed in these commentaries that Jesus’ own words give us the truth about a future generation like the one described by Paul. It is the Lord’s prophecy about the generation who will be alive when He next intervenes catastrophically into the wicked affairs of humankind. He said it will be just like it was during the time of Lot Sodom.

Likewise also as it was in the days of Lot; they did eat, they drank, they bought, they sold, they planted, they builded; But the same day that Lot went out of Sodom it rained fire and brimstone from heaven, and destroyed them all. Even thus shall it be in the day when the Son of man is revealed. (Luke 17:28–30)

While there are many things we can call “evil” and “wicked,” there is a specific form of wickedness that marked Lot’s day, as we all know. God came down to Abraham, Lot’s uncle, to say He was going to check Sodom to see if all the wickedness was taking place. Of course, God knew the state of that debauched society and culture. After Abraham tried to bargain with the Lord, asking if he would spare the city if a certain number of righteous people could be found, and only Lot fell into that category, God destroyed the city after removing the only righteous people–Lot and his daughters.

The primary evil reported in the Word of God concerning God’s judgment of and destruction of Sodom was the sexual debauchery rampant in the city. The sexual wickedness, according to Genesis 19, was that of homosexuality.

Again, Paul mentions this:

For this cause God gave them up unto vile affections: for even their women did change the natural use into that which is against nature: And likewise also the men, leaving the natural use of the woman, burned in their lust one toward another; men with men working that which is unseemly, and receiving in themselves that recompence of their error which was meet. (Romans 1:26–27) 

Jude tells of this matter that angers the God of Heaven to the point that He must act in His perfect righteousness. Many who read the little book of Jude are struck by his word that is ubiquitous in his prophecy for the very end of humanity’s war against the God who created them. That word is “ungodly”:

And Enoch also, the seventh from Adam, prophesied of these, saying, Behold, the Lord cometh with ten thousands of his saints, To execute judgment upon all, and to convince all that are ungodly among them of all their ungodly deeds which they have ungodly committed, and of all their hard speeches which ungodly sinners have spoken against him. These are murmurers, complainers, walking after their own lusts; and their mouth speaketh great swelling words, having men’s persons in admiration because of advantage. But, beloved, remember ye the words which were spoken before of the apostles of our Lord Jesus Christ; How that they told you there should be mockers in the last time, who should walk after their own ungodly lusts. These be they who separate themselves, sensual, having not the Spirit. (Jude 21: 14-19)

Jude, in his condemning prophecy about ungodliness, gave an example of the wickedness that would bring God’s wrath.

Even as Sodom and Gomorrah, and the cities about them in like manner, giving themselves over to fornication, and going after strange flesh, are set forth for an example, suffering the vengeance of eternal fire. Likewise also these filthy dreamers defile the flesh, despise dominion, and speak evil of dignities. (Jude 1:7–8)

Jesus, Paul, and Jude were speaking of our own time so near the end of this Age of Grace, I have no doubt. The following news story should make it clear as to the above prophecies could very likely apply to this very hour.

A video of a mock “de-baptism” ritual at a Michigan LGBT “pride” festival has emerged on Instagram.

The video shows a man in an orange shirt reading “God Hates FAGs” pointing an unplugged hairdryer labelled “reason” at a woman’s head.

The Instagram user said she underwent the ceremony at Lansing Pride 2025.

She reflected on being baptized in the Mormon Church at age 8, saying she had been baptized without “informed spiritual consent.” She described the “de-baptism” as a moment of release and healing, writing, “Dry, whole, and finally, by my own choice.”

The booth offering the ritual was hosted by “Michigan Atheists,” which described the ceremony as “a powerful act of self-affirmation.” The group also pledged support for gender ideology under the banner of “freedom of expression.” It plans to offer similar activities at “Royal Oak Pride” and “Ann Arbor Pride” later this summer.

So-called “de-baptism” (and “un-baptism”) ceremonies have also become common amongst satanist groups.

“Lansing Pride” itself featured over 200 vendors and performances. This year’s events included the “Free to Bee Family Zone” for children, which offered drag story times, free books, and LGBT-themed activities aimed at “empowering kids to embrace and celebrate differences.” (“LGBT ‘pride’ participants undergo sacrilegious ‘de-baptism’ ritual,” LifeSite, Rapture Ready News July 3, 2025)

What more appropriate word to use in defining such wickedness than that word used by the prophet Jude in describing Christ’s return to judge such evil? “Ungodly”is that word and, as Jude describes, ungodliness is worthy of God’s wrath.

For those caught up in the wickedness of this age so near the Tribulation, here again is how to accept God’s forgiveness and not come under His wrath and judgment that is swiftly approaching.

That if you will confess with your mouth the Lord Jesus, and will believe in your heart that God has raised Him from the dead, you will be saved. For with the heart man believes unto righteousness; and with the mouth confession is made unto salvation. (Romans 10:9–10)

Terry James Prophecy Line HOMEPAGE

ABOUT Terry James Prophecy Line

President Donald Trump, MAGA, Common Ground, Dem Tyranny, Prophetic Tyranny, Terry James, Steve Eichler,

Remember to be an Anti-Medical-Tyranny Activist!


Stop History from Repeating

John R. Houk, Blog Editor

© June 27, 2025

The year 2025 is half over. For most of us (especially Conservative-Patriots) the Chy-Na virus (aka COVID) is long past seeing in the rear view mirror. Occasionally I still see a brainwashed person wearing a mask (and I live in a Red-State). My first thought in seeing a mask-wearer is, “I bet he/she is a brainwashed voting Dem.”

AND more and more evidence (including peer reviewed papers) keep emerging that mRNA is definitely dangerous in varying degrees meaning it is UNSAFE & INEFFECTIVE. And yet the brainwashed are still taking mRNA boosters yet statistically in less and less amounts of the population.

All that being said, I’ve noticed in occasional comments, the sentiment that people have is they would just like to forget that tyrannical debacle was ever imposed on the human race on a global scale.

FRIENDS (the brainwashed I have no doubt are not friends), history has a bad habit of repeating cyclically. That means attempts to control with fear-tyranny will reemerge in the next cycle an oligarchy of tyranny feel the need to impose its will on the masses.

So, remember what was in the rear view and take action (beginning locally) to PREVENT the next Tyranny Cycle. Below a series of video titles that I pray reinvigorates your memory for there will always be a tyranny to resist. WATCH one or two or all as you choose to remember:

  • Vaxxed 3 – Authorized To Kill (Rumble & UGETube 1.56.37-Hours)
  • Inside China’s Stranglehold on the Global Medicine Supply Chain – Rosemary Gibson (UGETube & Odysee 56.59-Minutes)

JRH 6/28/29

READER SUPPORTED!

PLEASE! I need more Patriots to step up. I need Readers to chip in $5 – $10 – $25 – $50 – $100 (PAYPAL – one-time or recurring). YOUR generosity is APPRECIATED. PLEASE GIVE to Help me be a voice for Liberty:

Please Support CPCR

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

Our Senior Citizen Family Supplements our income by offering healthy coffee products. BETTER YOUR HEALTH with healthy & good tasting COFFEE and enjoy some weight management supplements. BUY Happy Coffee & Weight Loss Supplements at the Diana Wellness Store: https://dianawellnessstore.com

>>HAPPY HEALTHY COFFEE & PERFORMANCE DUO WEIGHT MANAGEMENT<<

*********************************

TruthTube VIDEO: THE TRUE HISTORY OF COVID, STARTING IN 1965 IN THE U.S.A.

Posted by Elgato Weebee

Posted on 25 Jun 2025

Elgato has reposted a David Martin/London Real interview that behooves people to watch (OR watch again) in an effort to prevent history repeating in the future. Is it possible to stop history repeating? ONLY with awareness and the ACTIVISM of the MANY. H/T Elgato Weebee’s WordPress Blog post from 6/26/25: https://elgatoweebee.wordpress.com/2025/06/26/my-daily-posts-for-thursday-june-26-2025/

Elgato’s Description:

“THERE ARE MANY NARRATIVES ABOUT COVID, THE SO CALLED “PANDEMIC” AND THE VACCINES BUT THERE’S ONLY ONE TRUTH. Dr DAVID MARTIN TELL US THE TRUTH ABOUT COVID, STARTING IN 1965.”

++++++++++++++++++++++++

Rumble VIDEO: DEBUNKED- ‘Millions Saved’ COVID-19 Vaccine Study Torn to Shreds

Posted by SlantRight

Published June 27, 2025

This video is from Substack Focal Points – Courageous Discourse (https://www.thefocalpoints.com/). It was posted 5/18/25 under the full title: “DEBUNKED: “Millions Saved” COVID-19 Vaccine Study Torn to Shreds: Dr. Raphael Lataster’s new meta-critique exposes the flawed math, false assumptions, and hidden conflicts behind the infamous “14 million lives saved” vaccine claim” (https://tinyurl.com/yc8cscv9).

The Substack post provides text, photos & charts offering integrity to the video.

First Paragraph of Focal Points Post:

“In this revealing episode, epidemiologist Nicolas Hulscher sits down with Dr. Raphael Lataster (https://tinyurl.com/3ba8sra4) to dismantle the widely cited Watson et al (https://www.thelancet.com/pdfs/journals/laninf/PIIS1473-3099(22)00320-6.pdf) study, published in The Lancet, which claimed COVID-19 vaccines saved 14.4 million lives in a single year.”

+++++++++++++++++++++

Rumble/UGETube VIDEO: Vaxxed 3 – Authorized To Kill

Posted by SlantRight/John Houk

Published June 27, 2025

This Documentary/Exposé is from CHD.tv (https://live.childrenshealthdefense.org/chd-tv/) posted originally on 10/4/24 (https://live.childrenshealthdefense.org/chd-tv/videos/vaxxed-3-or-authorized-to-kill-movie/). I rediscovered the video from a 4/14/25 Children’s Health Defense (https://childrenshealthdefense.org/) email subscription.

I am unsure of CHD.tv copyright vs Fair Use doctrine so I am uploading the Documentary to both my Rumble and UGETube Channels (UGETube leans more toward Fair Use).

CHD.tv Description:

“Children’s Health Defense embarked on a nine-month journey across America, gathering powerful testimonies from the people. Our interviews ranged from mothers and fathers to teenagers, families, medical professionals, whistleblowers, lawyers, and people from all walks of life.

What we discovered was nothing short of staggering. We listened to harrowing accounts of COVID hospital protocols that shook us to our very core. The consistency of these stories was alarming.

People also shared their experiences after taking the COVID-19 vaccine, revealing tragic outcomes of either death or serious injury. Now, fueled by these powerful firsthand testimonies, we are creating a documentary by the people, for the people.

Learn what we uncovered on the road. You can’t afford to miss it.”

SUPPORT Children’s Health Defense: https://childrenshealthdefense.org/about-us/donate/?itm_term=chd-tv

+++++++++++++++++++

UGETube/Odysee VIDEO: Inside China’s Stranglehold on the Global Medicine Supply Chain – Rosemary Gibson

Posted by John Houk/SlantRight 2.0

Published June 27, 2025

This American Thought Leaders (https://www.theepochtimes.com/epochtv/american-thought-leaders) Episode was posted on 4/10/25 (https://tinyurl.com/3yxjrhzj). Jan Jekielek interviews Rosemary Gibson about America depending on Communist China to make & produce the medicines Americans purchase and use. THIS MUST CHANGE! It is time to Make Medicine in America Again!

American Thought Leaders Description:

“[RUSH TRANSCRIPT (at Epoch TV)] “The United States depends on China for 95 percent of the key components that are necessary to make our generic drugs, and if China shut the door on exports, within months, our health care system would begin to collapse.”

Rosemary Gibson is a national authority on health care policy and patient safety, and the author of “China Rx: Exposing the Risks of America’s Dependence on China for Medicine.”

“How come we don’t know that our medicines are being made in China? And this has been going on for a long time, and for years, there was actually zero regulation. How do we outsource production from a country with the highest standards in the world to places with no standards?” she asks.

In this episode, we dive into the realities of China’s control of America’s medical supply chain, the increasing problem of contaminated medications, and what the current administration can do to fix it.

Views expressed in this video are opinions of the host and the guest, and do not necessarily reflect the views of The Epoch Times.

++++++++++++++++++++

Rumble VIDEO [H/T Substack Liberty Sentinel]: Contaminated COVID Shots & US Funding for Wuhan: Govts Must Act | Behind The Deep State

Posted by The New American

Published April 14, 2025

As a handful of governments begin to ask the hard questions about contamination in the dangerous Covid shots forced on humanity and the strange origins of the pandemic as well as the documented U.S. government funding, it is time for accountability and justice, argued legendary lawyer, physicist, and medical doctor Dr. Richard Fleming.

Speaking in an interview on Behind The Deep State with The New American magazine’s Alex Newman, Dr. Fleming explains the findings of Slovakian authorities in explosive new research that he collaborated on and confirmed. In short, there is more than enough information now for Secretary of Health and Human Services Robert F. Kennedy Jr. to act.

+++++++++++++++++++

Rumble VIDEO: BOMBSHELL PFIZER WHISTLEBLOWER DROPS NUCLEAR TRUTH on COVID VACCINE FORMULA SWAPPED IN SINISTER FDA FRAUD

Posted by SlantRight

Published June 27, 2025

This Alex Jones/Infowars segment is from Telegram Alex Jones (https://t.me/AlexJonesOfficiaI) posted on 4/26/25 (https://t.me/AlexJonesOfficiaI/665).

Alex Jones Description:

BOMBSHELL PFIZER WHISTLEBLOWER DROPS NUCLEAR TRUTH: COVID VACCINE FORMULA SWAPPED IN SINISTER FDA FRAUD!

1. PFIZER’S FORMULA FLIPPED AFTER TRIALS!

Justin Leslie, armed with damning videos and documents, revealed Pfizer pulled a fast one on the FDA.

After clinical trials, they swapped the vaccine’s phosphate buffer saline (PBS) for a tris buffer system.

Why?

The PBS needed -80°C storage, but the tris allowed easier distribution. Problem is, ALL trial data was based on the PBS formula—NOT the tris one injected into kids!

Pfizer VP Nick Warren admitted at a 2021 VRBAC meeting they secured a shady “bioequivalence agreement” with the FDA, skipping new trials.

This is a GLOBAL clinical trial betrayal, folks, and it targeted 5–11-year-olds who couldn’t consent!

2. NO INFORMED CONSENT

This wasn’t just a tweak—it was a full-on bait-and-switch.

Parents were lied to, told the vaccine was tested, when the tris buffer version was untested on humans!

Leslie calls this a violation of the Nuremberg Code, a crime so heinous it demands justice beyond life in prison.

The FDA’s complicity?

They let Pfizer slide, ignoring informed consent rules.

Vaccine recipients were supposed to get fact sheets detailing risks, but Pfizer kept the switch under wraps, laughing in the face of humanity!

3. TURBO CANCERS AND TOXIC NANOTECH

The vaccine’s lipid nanoparticles (LNPs), like ALC-0315, are REGISTERED CARCINOGENS with the FDA.

Leslie links these to “turbo cancers” exploding across the globe and vaccine injuries mislabeled as “long COVID.”

Under a microscope with Project Veritas and Dr. Karen Mide, vaccine vials revealed horrifying contents.

This isn’t a vaccine—it’s a nanotech nightmare, mass-producing synthetic sludge in your body, clogging arteries, and triggering heart attacks.

And get this: Pfizer KNEW, adding anticoagulants to some batches to mask the carnage!

4. KIDS AS GUINEA PIGS

At the FDA’s 2021 VRBAC meeting, Senior VP Dr. Bill Gruber admitted the vaccine’s safety for kids was a gamble.

He voted to approve it, saying they needed to give it to children to “see if it’s safe.” You read that right—they turned kids into lab rats!

Meanwhile, media shills like Rachel Maddow, allegedly raking in $89,000 per show on top of millions, parroted “safe and effective” lies.

Biden, Pfizer CEO Albert Bourla, and BioNTech’s Ugar Sahin pushed 95–99% efficacy claims, knowing the truth was a deadly question mark.

5. BATCHES OF DEATH

Leslie’s intel exposes Pfizer and Moderna playing Russian roulette with vaccine batches.

Some doses were juiced with higher illness and death rates, sent to specific regions like a twisted range-finding test.

This wasn’t a side effect—it was THE effect.

Heart attacks, strokes, and clots were normalized with billboards claiming “kids having heart attacks is normal.”

Pure evil, premeditated, and in-your-face!”

+++++++++++++++++++++

Bitchute VIDEO: 4 Landmark Studies – mRNA Shots Are NOT SAFE FOR HUMAN USE

Posted by SlantRight2

Published June 27, 2025

This clip was found at Telegram Dr. Judy Mikovits (https://t.me/DrJudyMikovitsHealthSecrets) posted on 4/19/25 (https://t.me/DrJudyMikovitsHealthSecrets/966).

Dr. Judy Mikovits Description:

“184 Million People, 4 Landmark Studies: COVID-19 mRNA Shots Are NOT SAFE FOR HUMAN USE 🚫

🩸 Autopsies. Heart Attacks. Strokes. Multi-Organ Failure — The Data Are In 👇

📍FAKSOVA ET AL (n=99 million):

➊ Myocarditis (+510% after mRNA injection)

➋ Acute Disseminated Encephalomyelitis (+278% after mRNA injection)

➌ Cerebral Venous Sinus Thrombosis (+223% after viral vector injection)

➍ Guillain-Barré Syndrome (+149% after viral vector injection)

📍RAHELEH ET AL (n=85 million):

➊ Heart Attack (+286% after second dose)

➋ Stroke (+240% after first dose)

➌ Coronary Artery Disease (+244% after second dose)

➍ Cardiac Arrhythmia (+199% after first dose)

📍HULSCHER ET AL (n=325 autopsies):

◾️Proved a causal link between COVID-19 vaccines and death via multiple organ systems.

📍ALLESSANDRIA ET AL (n=290,727):

◾️Subjects vaccinated with 2 doses lost 37% of life expectancy compared to the unvaccinated population during follow-up.

IMMEDIATE market withdrawal of the COVID-19 mRNA injections is essential to prevent further loss of life among the 9 million American children still receiving them.

In light of the overwhelming safety signals confirmed in the largest studies ever conducted, continued administration of these products now constitutes mass negligent homicide.”

+++++++++++++++++++

Bitchute VIDEO: Vaccines violate the Nuremberg Code and are causing brain damage

Posted by SlantRight2

Published June 27, 2025

This clip is from Telegram COVID19 VACCINE VICTIMS AND FAMILIES (https://t.me/COVID19VACCINEVICTIMSANDFAMILIES) posted on 4/23/25 (https://t.me/COVID19VACCINEVICTIMSANDFAMILIES/3041).

COVID19 VACCINE VICTIMS AND FAMILIES Description:

“@MaryHollandNYC of @ChildrensHD lays out the devastating truth Big Pharma wants hidden.

@SecKennedy’s radical transparency is about to expose it all.”

++++++++++++++++++

Bitchute VIDEO: NIH Director Jay Bhattacharya on mRNA Tech

Posted by SlantRight2

Published June 27, 2025

I found this clip at Telegram Stand Against Tyranny World Wide (https://t.me/StandagainstTyrannyWorldWide) posted on 4/27/25 yet forwarded from Dr. Judy Mikovits (https://t.me/dr_judymikovitss) with the link: https://t.me/dr_judymikovitss/2339.

Stand Against Tyranny World Wide Description:

“The next step is [to halt] the mRNA platform itself… the manufacturer has no idea what dose they’re giving, no idea where it goes in the body, and whether they are producing off-target antigens”

Fascist Family Values?


The above REBLOG is from insanitybytes (https://insanitybytes2.wordpress.com/) WordPress Blog. I was hoping when I pressed the REBLOG button it would at least post a paragraph or two. Since that didn’t happen, below is an excerpt (https://insanitybytes2.wordpress.com/2025/05/27/fascist-family-values/):

“…

Which brings me to the Seattle Times who ran the headline, “12 arrests Made At Heated Fascist Family Values Protest.” Fascist Family Values? You have got to be kidding me! It wasn’t fascist at all. Fascism is when you attack and assault people, including cops because you don’t like free speech. Fascism is when your government feels as if it has the right to censor people’s right to assemble and gather, on public land with a permit.

Capital Hill Seattle Blog did only slightly better, labeling them, “a fundamentalist church group.” Fundamentalist is probably better than Fascist but you don’t have to read between the lines to pick up on the outright contempt. …”

JRH 5/27/25

READER SUPPORTED!
PLEASE! I need more Patriots to step up. I need Readers to chip in $5 – $10 – $25 – $50 – $100 (PAYPAL – one-time or recurring). YOUR generosity is APPRECIATED. PLEASE GIVE to Help me be a voice for Liberty:
Please Support CPCR
Big Tech Censorship is pervasive – Share voluminously on all social media platforms!
Our Senior Citizen Family Supplements our income by offering healthy coffee products. BETTER YOUR HEALTH with healthy & good tasting COFFEE and enjoy some weight management supplements. BUY Happy Coffee & Weight Loss Supplements at the Diana Wellness Store: https://dianawellnessstore.com

>>HAPPY-HEALTHY COFFEE DETAILS<<

Please RESIST Tyranny


John R. Houk, Blog Editor

January 8, 2023

So much tyranny. So much mistrust of a lying Government installed by a coup AND ratified by Checks-And-Balances FAILURE – Constitutional Shredding. Once upon a time American Exceptional Patriots are propaganda-labelled as Domestic Terrorists and/or Insurrectionists (WHEN THE LABEL SHOULD BE APPLIED TO TREASONOUS LEFT).

With that unfortunate piece of pessimism, I am posting some essays and videos that I pray gets somebody to think RESISTANCE. Always peaceful yet self-defense violence if/when necessary.

TITLES:

JRH 1/8/23

Thank you to those who have stepped up!

READER SUPPORTED! I need Readers willing to chip in $5 – $10 – $25 – $50 – $100. PLEASE I need your generosity. PLEASE GIVE to Help me be a voice for Liberty:

Please Support CPCR

YOU CAN ALSO SUPPORT via buying healthy supplements/products from Online stores (mine & my Honey):

My Store (please use referral code 2388058): https://modere.co/3SrOHzI

My Better Half’s Store (please use referral code 3917004): https://dianahouk.shiftingretail.com/  

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

************************

Bitchute VIDEO: JAN 6 POLITICAL PRISONERS AND THE INVERSION OF JUSTICE IN AMERICA

Posted by BANNED.VIDEOInfowars

First Published January 7th, 2023 21:45 UTC

https://gregreese.substack.com/

https://banned.video/channel/greg-reese

++++++++++++++++++

Gosar: ‘The Effort to Attempt a Coup Between Traitor General Mark Milley and Pelosi Will be Exposed’

Paul Gosar & Gen Mark Milley the Traitor – Photo: Sage Skidmore

By CULLEN MCCUE

January 7, 2023 (Last Updated on January 7, 2023)

National File

U.S. Rep. Paul Gosar (R-AZ) vowed to bring “traitor” general Mark Milley to justice in a tweet Saturday. Gosar, Rep. Dan Bishop (R-NC) and Rep. Chip Roy (R-TX), among others, had been lobbying for the establishment of a “Church Commission-style” investigation into the weaponization of the FBI against Americans, as well as alleged federal government coordination with January 6 instigators. Under a compromise between newly elected House Speaker Kevin McCarthy (R-CA) and his 20 dissenters, such a committee will be established. Many conservative pundits and voters have expressed skepticism, however, as they do not trust McCarthy to follow through.

“Remember – we will conduct a real investigation into J6. The effort to attempt a coup between traitor Gen. Mark Milley and Pelosi will be reviewed and exposed,” Gosar wrote in a tweet Saturday.

“Milley’s treasonous sell out to China will be investigated. Pelosi not warning members about intel of impending violence will be exposed,” he continued. “Soon, we’ll know the truth.”

Generally Mark Milley once “warned” the Chinese Communist Party that he would not follow orders from then-outgoing President Trump in late 2020.

Bob Woodward’s book Peril revealed that General Milley held a secret Pentagon meeting behind President Trump’s back where he instructed his staff to ignore orders given by the President a few days after January 6. The purpose of the meeting was centered on Milley’s belief that President Trump would order the use of nuclear weapons towards the end of his term.

CNN reported that Milley “called a secret meeting in his Pentagon office on January 8 to review the process for military action, including launching nuclear weapons. […] Milley instructed them not to take orders from anyone unless he was involved.”

“You never know what a president’s trigger point is,” Milley reportedly told his staff. “No matter what you are told, you do the procedure. You do the process. And I’m part of that procedure,” Milley said. “Got it?” His senior staff replied, “Yes, sir.”

The book also reveals that Miley had secretly coordinated with a top Communist Chinese general in the days following January 6 behind President Trump’s back. “General Li, I want to assure you that the American government is stable,” Milley said, according to a transcript, “and everything is going to be okay.”

Gosar, Bishop and a number of additional House Republicans have called for Milley to be investigated and eventually arrested over his actions. “If this report is true, Gen. Milley didn’t act heroically as his leftist media allies are pretending, he sold America out & should be court-martialed,” Bishop wrote in a tweet shortly after the revelation. [Defense Secretary] Austin needs to get to the bottom of it. America deserves better than a rogue General who colludes with an adversary.”

Just weeks prior to the pivotal Speaker battle, Gosar, Bishop and Reps. Chip Roy (R-TX), Scott Perry (R-PA), Andrew Clyde (R-TX), as well as freshman Reps. Andy Ogles (R-TN) and Eli Crane (R-AZ) signed a letter calling for a  a “Church Commission-style committee to target weaponized government.”

“Create one centralized, empowered investigation and action committee to frame and carry out the fight against weaponized government in coordination with other critical standing committees (e.g., the House Judiciary and Oversight Committees), one that is fully engaged in the critical work of regular, detailed oversight and empowered with subpoena authority,” reads the letter.

All seven Representatives initially voted against McCarthy, though they ultimately switched their votes after McCarthy agreed to the concessions.

© 2022 NationalFile.com National File, LLC.  About Us. All Rights Reserved.

+++++++++++++++++++++++

Uniparty Peace or Violence?

Will the Uniparty relent, give power back to the people and bring us peace and stability or hold on to their power with a jealous obsession and inevitably bring about violence? What does history say?

Uniparty Photo on CFP

By Ray DiLorenzo

January 7, 2023

Canada Free Press

Those who make peaceful revolution impossible will make violent revolution inevitable  ~  John F. Kennedy

Is violent or peaceful revolution on the horizon?  The United States of America as the ‘Great Experiment’ in self-government is failing.  While people slept, elites have been allowed to take over, not in governing, but in ruling.  Elections are awash in fraud.  Government institutions are seemingly impotent in applying checks and balances…corruption is overflowing.  Our culture has been pushed to decline by a godless social ideology.  The elite have taken an active part.  They know the world is about to collapse or be changed, but they are prepared, lifeboats at the ready, while the common folk stare at the cold water nearing their feet.

Mitch McConnell is a RINO in the first degree, a failure and a disgrace

People are now talking about the Uniparty.  Who are they?  What are they?  The Uniparty is a resurrected buzzword for the joining of the Democrat and Republican establishment to obfuscate the will of the American people and push forward The Great Reset for their own interests.  The perfect marriage.  They’re a veritable fifth column working to destroy America as founded, sometimes competing with each other for lead turncoat.  It includes bureaucrats, members of the media, big business, and academia. The Republicans involved (RINOS) are closer to Democrats than members of their own party, but many are so far up in seniority they dare not leave the party. They have become an unrecognized third party, more recently, a party dedicated to stopping the outsider, Donald Trump.


Make no mistake, Mitch McConnell would rather be Minority Leader in the Senate than just a senator in a majority Senate.  Why else would he withdraw millions in support of 2022 Senate candidates?  He’s responsible for trillions in spending under Biden and the inflation we are all feeling.  He is a RINO in the first degree, a failure and a disgrace.


Polled Democrats and Republicans say they are not well represented in government (PRRI).  Except for a brief respite during the Trump presidency, the GOP hasn’t truly represented their voters for many years.


The term Uniparty has been applied loosely from time to time from at least FDR, but Ralph Nader gave it proper context in 2000 meaning the Washington establishment.  People have used ‘Uniparty’ for various purposes, neo-liberalism, green causes and the like.  But, it is now used primarily by conservatives to attack the linking of mainstream Republicans and Democrats against America First or conservatism.

Did we really vote for increased crime, inflation, higher taxes, open borders, more drug trafficking, censorship, the elimination of any morality?


The Uniparty is not on our side.  They are essentially socialist and globalist or just lowlifes looking for opportunity.  They are a government within a façade of a government.  They have an agenda, and you are not part of it.


Even though George Washington abhorred the thought of political parties, the human trait of forming tribes was always too great.  And now the tribe mentality has crossed party lines.


Why does it seem like America is on a fast track to a destination no one voted for?  No matter how we vote, no matter what we say, no matter what we reject in the market place, the country seems headed over a cliff, and we have no control over it.  How is it that Trump was able to turn our country around a full 180 degrees in just a few short years?  We were being held back by past administrations.


The Uniparty has put our country on autopilot and programmed that autopilot with no input from the people.


With only 15% of Americans saying our country is going in the right direction (AP), did we really vote for increased crime, inflation, higher taxes, open borders, more drug trafficking, censorship, the elimination of any morality?  Do Americans want 4,000 page bills smelling of pig, made into law in the middle of the night that no one has read?  Do Americans want legislation written in the shadows?

Why do the Biden, Clinton and Pelosi families get to break any law they want?

Why can’t we win an election that reflects the voter’s sentiment?  Even Democrats are getting nervous (80%).  Why do Disney and Hollywood keep releasing movies that shock our moral conscience, even when they fail at the box office? Hollywood complains that their earnings have fallen, yet they continue to give us junk.  Why is it more profitable to stay home rather than work?  Why do politicians seem to ignore their constituents?  Why do the Biden, Clinton and Pelosi families get to break any law they want?  Why does Congress name bills that don’t reflect content.  Over a year and a half ago, Congress approved Biden’s $2.5 trillion infrastructure bill.  Where’s the infrastructure?  Now we find out that only 25% of the bill had anything to do with infrastructure. We did get a $20 million heated sidewalk.

 
Americans were lied to with regularity during the Bush and Obama administrations and now with Biden.  We were not allowed to get what we wanted during the Trump administration… nor were we allowed to get what we voted for in 2020 and in 2022.  Not allowed?  By whom?  The Globalist Uniparty.  Since Tucker Carlson reported that the CIA had a hand in the JFK assassination, one can imagine Uniparty implication.


Representative Constitutional Democracy is dead in America!  It is dead because the Uniparty has willed it so.  Their power is more important than your freedom and liberty. It is considered ultra-conservative today to preserve our nation as founded. There is, however, a cadre of Republicans like Andy Biggs (AZ), Bob Good (VA), Andy Harris (MD), Lauren Boebert (CO), Matt Gaetz (FL), Matt Rosendale (MT), Eli Crane (AZ), Chip Roy (TX), and Byron Donalds (FL) that are determined to fix Washington, and they will not be deterred.  They refuse to compromise with a political cartel that is destroying America, or Kevin McCarthy who has a Conservative Review score of 54% (F).  They are our last refuge in this government…true courage!  These Representatives are doing their job.  They are representing their constituents who put them there and standing for the principles for which this country was founded.  What a concept. Maybe McCarthy will lower his head a bit in remorse for his past political transgressions.

Trump was sold as the anti-establishment president, yet many of his appointments were head scratchers


We are no longer the same country. It’s in the hands of the globalist establishment and they are not about to let go.  Oh, they may have allowed us to win a thin margin in the House because the number of votes couldn’t be overcome, or they just want us to think everything is normal, but who is the Speaker of the House?… an establishment shill?

 
Trump was sold as the anti-establishment president, yet many of his appointments were head scratchers.  It was a swinging door.  It was no surprise that he couldn’t get the wall built or the swamp drained.  Paul Ryan was Uniparty. Trump constantly criticized Bush’s WMD/Iraq war and then he appointed Bolton as National Security Advisor.  Go figure.


I am not an anti-Trumper, but during the Trump administration, it became apparent that it was going to take more than a president to fix this country.  Trump was checked at every turn until his checkmate in 2020.


In times of emergency, some react quickly, some slowly, needing time to process, in many cases to their detriment.  Now that agents from Hell are working to undermine our nation, removing the foundation holding it up, people are still trying to process what is happening in spite of all the evidence.  Time is running out.

“I fear all we have done is awaken a sleeping giant and fill him with a terrible resolve.” 

My great fear is that the Uniparty is going to continue destroying our country for their purposes without opposition. Elections now seem futile.  The judicial system has been neutered.  Congress and the judiciary does not act even when they have legal precedent. Partisanship has taken the place of patriotism. Too many of our patriot politicians are mealymouthed, instead of expressing outrage. Profiles in courage seems relegated to a remote past.


The new Congress must take the lead in fixing our country.  If the people take the lead, it is not going to be pretty. If enough people feel they no longer have a say in our government, my fear is that they will push back, and push back hard.  Americans will put up with just so much.  Admiral Yamamoto recognized this after Pearl Harbor and said with regret, “I fear all we have done is awaken a sleeping giant and fill him with a terrible resolve.”


Will the Uniparty relent, give power back to the people and bring us peace and stability or hold on to their power with a jealous obsession and inevitably bring about violence?  What does history say?

Ray DiLorenzo is a career pilot having retired after 22 years as a contract fire pilot with the California Department of Forestry (Cal-Fire).  He is presently affiliated with Stand Up America US Foundation founded by Maj. Gen. Paul E. Vallely (Ret).

Copyright 1997-2022 Canada Free Press.Com

+++++++++++++++++

2023: The Deep State, Police State, and Nanny State Walk Into a Bar…

The more we and others recognize the machinations of the Deep State, the better our chances are that we’ll be able to fight back.

By JD Rucker

January 8, 2023

America First Report

We’re seeing a joke forming in 2023. Unfortunately, there’s nothing funny about the punchline. The Deep State is coming out of the shadows and coopting the rising police state. Combined, they form the ultimate weapon to be used against the people with the increasingly prevalent nanny state telling us what we can and cannot do.

All the stories I will talk about on today’s radio version of The JD Rucker Show are focused on this premise. We are witnessing the Deep State do things in recent months that go against their past norms. They’ve always operated in the shadows with zero transparency to the public and limited transparency to the government officials, most of whom they control anyway. Lately, they’ve been far more bold with their public posture.

It’s no coincidence that the Twitter Files are exposing them. I believe this is intentional. That’s not to say Elon Musk or the journalists he tasked with revealing the Twitter Files are complicit in the Deep State’s agenda. On the contrary, I think they are doing a fine job and have the right intentions, but let’s face it. If the Deep State didn’t want the information to come out, it never would have.

The same can be said about recent “whistleblowers” painting the CIA as directly involved in the assassination of John F. Kennedy Jr. Again, I do not believe the information would have been leaked out conveniently at about the same time unless the Deep State allowed it. They WANT us to be concerned about them, including “normies” who may have never even heard of the Deep State or assumed it was conspiracy theory fodder. For those who think that’s silly because it implicates them, I ask this: Does it really? Are you hearing about people getting fired or arrests being made at the CIA? Are they losing budget over this? Is anyone really pressing them? Or is it all fodder to make us think the truth is coming out when in reality they’re facing zero consequences as a result?

Now, we’re seeing the rising police state policies being used by the Deep State to promote the tyranny of the nanny state. It’s confusing, but hear me out. Police state policies include the use of technologies to keep track of us at all times. They position these things as a positive.

For example, the capture of alleged Idaho murderer Bryan Kohberger and much of the evidence that will be used to convict him were procured by the police state through “advanced” methods. We will all cheer if he is convicted and ignore the fact that the FBI used DNA they acquired from a family history service like Ancestry.com or 23 and Me. Has your DNA been given to a company that will tell you your great, great grandmother was Irish? If so, the Deep State has your DNA.

The use of cell phone pings was instrumental in locating Kohberger. But the same people who were able to pinpoint his location this way claim identical technology used in 2000 Mules is inaccurate. They’ll also ask us to ignore the fact that they had isolated cell location data on the January 6 pipe bomber. We’ve even seen security footage showing the bomber using his phone on his way to drop off the bombs. The FBI increased the reward to $500,000 for information about a man they almost certainly already know. It’s all Kabuki Theater.

Now, take it all a step further with the nanny state driving the narrative that we need government to control our lives. Will the Deep State use the police state to go after people who are insufficiently limiting their carbon emissions or eating too much meat? Will they track people who don’t want to participate in the Digital Dollar as their only means of commerce? Will they put people like you and me on a list of potential domestic terrorists because we aren’t getting jabbed?

An article by John and Nisha Whitehead breaks down what they believe to be 19 of the steps that our government will take this year to bring us closer to total tyranny. I will cover this in today’s episode and expand on some of the pieces, which are listed below. I don’t agree with all of them but I am preserving their writing because we don’t always have to agree on everything. They’re close enough, so it’s a worthwhile post.

Let me know what you think about their list in the comments.

What to Expect from the Government in 2023? More of the Same [Blog Editor: I provided the embedded link to The Rutherford Institute post from 1/5/23]

There is no greater tyranny than that which is perpetrated under the shield of the law and in the name of justice.”—Montesquieu, Enlightenment philosopher

For those wondering what to expect from the government in 2023, it looks like we’re going to be in for more of the same in terms of the government’s brand of madness, mayhem, corruption and brutality.

Digital prisons. Unceasingly, the government and its corporate partners are pushing for a national digital ID system. Local police agencies have already been given access to facial recognition software and databases containing 20 billion images, the precursor to a digital ID. Eventually, a digital ID will be required to gain access to all aspects of life: government, work, travel, healthcare, financial services, shopping, etc. Before long, biometrics (iris scans, face print, voice, DNA, etc.), will become the de facto digital ID.

Precrime. Under the pretext of helping overwhelmed government agencies work more efficiently, AI predictive and surveillance technologies are being used to classify, segregate and flag the populace with little concern for privacy rights or due process. All of this sorting, sifting and calculating is being done swiftly, secretly and incessantly with the help of AI technology and a surveillance state that monitors your every move. AI predictive tools are being deployed in almost every area of life.

Mandatory quarantines. Building on precedents established during the COVID-19 pandemic, government agents may be empowered to indefinitely detain anyone they suspect of posing a medical risk to others without providing an explanation, subject them to medical tests without their consent, and carry out such detentions and quarantines without any kind of due process or judicial review.

Mental health assessments by non-medical personnel. As a result of a nationwide push to train a broad spectrum of so-called gatekeepers in mental health first-aid training, more Americans are going to run the risk of being reported by non-medical personnel and detained for having mental health issues.

Tracking chips for citizens. Momentum is building for corporations and the government alike to be able to track the populace, whether through the use of RFID chips embedded in a national ID card, microscopic chips embedded in one’s skin, or tags in retail products.

Military involvement domestically. The future, according to a Pentagon training video, will be militaristic, dystopian and far from friendly to freedom. Indeed, all signs point to the battlefield of the future being the American home front. Anticipating this, the government plans to have the military work in conjunction with local police to quell civil unrest domestically.

Government censorship of anything it classifies as disinformation. In the government’s ongoing assault on those who criticize the government—whether that criticism manifests itself in word, deed or thought—government and corporate censors claiming to protect us from dangerous, disinformation campaigns are, in fact, laying the groundwork now to preempt any “dangerous” ideas that might challenge the power elite’s stranglehold over our lives.

Threat assessments. The government has a growing list—shared with fusion centers and law enforcement agencies—of ideologies, behaviors, affiliations and other characteristics that could flag someone as suspicious and result in their being labeled potential enemies of the state. Before long, every household in America will be flagged as a threat and assigned a threat score. It’s just a matter of time before you find yourself wrongly accused, investigated and confronted by police based on a data-driven algorithm or risk assessment culled together by a computer program run by artificial intelligence.

War on cash. The government and its corporate partners are engaged in a concerted campaign to shift consumers towards a digital mode of commerce that can easily be monitored, tracked, tabulated, mined for data, hacked, hijacked and confiscated when convenient. This push for a digital currency dovetails with the government’s war on cash, which it has been subtly waging for some time now. In recent years, just the mere possession of significant amounts of cash could implicate you in suspicious activity and label you a criminal.

Expansive surveillance. AI surveillance harnesses the power of artificial intelligence and widespread surveillance technology to do what the police state lacks the manpower and resources to do efficiently or effectively: be everywhere, watch everyone and everything, monitor, identify, catalogue, cross-check, cross-reference, and collude. Everything that was once private is now up for grabs to the right buyer. With every new AI surveillance technology that is adopted and deployed without any regard for privacy, Fourth Amendment rights and due process, the rights of the citizenry are being marginalized, undermined and eviscerated.

Militarized police. Having transformed local law enforcement into extensions of the military, the Department of Homeland Security, the Justice Department and the FBI are moving into the next phase of the transformation, turning the nation’s police officers into techno-warriors, complete with iris scanners, body scanners, thermal imaging Doppler radar devices, facial recognition programs, license plate readers, cell phone extraction software, Stingray devices and so much more.

Police shootings of unarmed citizens. Owing in large part to the militarization of local law enforcement agencies, not a week goes by without more reports of hair-raising incidents by police imbued with a take-no-prisoners attitude and a battlefield approach to the communities in which they serve. Police brutality and the use of excessive force continues unabated.

False flags and terrorist attacks. Almost every tyranny being perpetrated by the U.S. government against the citizenry—purportedly to keep us safe and the nation secure—has come about as a result of some threat manufactured in one way or another by our own government. This has become the shadow government’s modus operandi regardless of which party is in power: the government creates a menace—knowing full well the ramifications such a danger might pose to the public—then without ever owning up to the part it played in unleashing that particular menace on an unsuspecting populace, it demands additional powers in order to protect “we the people” from the threat.

Endless wars to keep America’s military’s empire employed. The military and security industrial complexes that have advocated that the U.S. remain at war, year after year, are the very entities that will continue to profit the most from America’s expanding military empire abroad and here at home.

Erosions of private property. Private property means little at a time when SWAT teams and other government agents can invade your home, break down your doors, kill your dog, wound or kill you, damage your furnishings and terrorize your family. Likewise, if government officials can fine and arrest you for growing vegetables in your front yard, praying with friends in your living room, installing solar panels on your roof, and raising chickens in your backyard, you’re no longer the owner of your property.

Overcriminalization. The government has increasingly adopted the authoritarian notion that it knows best and therefore must control, regulate and dictate almost everything about the citizenry’s public, private and professional lives. Overregulation and overcriminalization have been pushed to such outrageous limits that federal and state governments now require on penalty of a fine that individuals apply for permission before they can grow exotic orchids, host elaborate dinner parties, gather friends in one’s home for Bible studies, give coffee to the homeless, let their kids manage a lemonade stand, keep chickens as pets, or braid someone’s hair.

Strip searches and the denigration of bodily integrity. Court rulings undermining the Fourth Amendment and justifying invasive strip searches have left us powerless against police empowered to forcefully draw our blood, forcibly take our DNA, strip search us, and probe us intimately. Individuals—men and women alike—continue to be subjected to what is essentially government-sanctioned rape by police in the course of “routine” traffic stops.

Censorship. First Amendment activities are being pummeled, punched, kicked, choked, chained and generally gagged all across the country. Free speech zones, bubble zones, trespass zones, anti-bullying legislation, zero tolerance policies, hate crime laws and a host of other legalistic maladies dreamed up by politicians and prosecutors have conspired to corrode our core freedoms. The reasons for such censorship vary widely from political correctness, safety concerns and bullying to national security and hate crimes but the end result remains the same: the complete eradication of what Benjamin Franklin referred to as the “principal pillar of a free government.”

Taxation Without Any Real Representation. As a Princeton University survey indicates, our elected officials, especially those in the nation’s capital, represent the interests of the rich and powerful rather than the average citizen. We are no longer a representative republic. With Big Business and Big Government having fused into a corporate state, the president and his state counterparts—the governors—have become little more than CEOs of the Corporate State, which day by day is assuming more government control over our lives. Never before have average Americans had so little say in the workings of their government and even less access to their so-called representatives.

Year after year, the government remains the greatest threat to our freedoms, and yet year after year, “we the people” allow ourselves to be suckered into believing that politics will fix what’s wrong with the country.

Indeed, as I make clear in my book Battlefield America: The War on the American People and in its fictional counterpart The Erik Blair Diaries, this is the very definition of insanity.

About the Author

Constitutional attorney and author John W. Whitehead is founder and president of The Rutherford Institute. His most recent books are the best-selling Battlefield America: The War on the American People, the award-winning A Government of Wolves: The Emerging American Police State, and a debut dystopian fiction novel, The Erik Blair Diaries. Whitehead can be contacted at staff@rutherford.org. Nisha Whitehead is the Executive Director of The Rutherford Institute. Information about The Rutherford Institute is available at www.rutherford.org.

© 2023 JD Rucker – America First Report

++++++++++++++++++

Bitchute VIDEO: LARA LOGAN – CRISPR, THE GOD GENE & THE NEW WORLD ORDER

Posted by Right2Freedom

First Published January 8th, 2023 04:23 UTC

Source: www.bitchute.com/video/zYumFvRcZ6iW/?list=subscriptions

Investigative journalist and defender of children Lara Logan joins me to discuss the agenda to destroy mankind as created in God’s image – and the battle for the very soul of the United States of America and its people.

+++++++++++++++++

BlackRock: The Company That Owns The World

BlackRock – Powerful Company Never Heard Of

By Jake Tran

JANUARY 8, 2023

Activist Post

During the 2008 Meltdown when the government bailed out too-big-to-fail giants like Bear Stearns, AIG, Fannie Mae, Freddie Mac – who did they hire to analyze and clean up the mess? Another giant financial firm by the name of BlackRock, led by a very well-connected billionaire by the name of Larry Fink. BlackRock was award these key government contracts to help with the meltdown with no competitive bidding while being enveloped in secrecy. Basically, Larry Fink was hired to be the manager of Washington’s bailout of Wall Street, even though BlackRock is one of the biggest shareholders in the same banks that they were helping to bail out.

In 2020, who did the money printer of the US, the Federal Reserve, hire to manage their scheme to buy corporate bonds? (Basically, they were bailing out corporations that had too much debt or needed to borrow money.) You guessed it, they went right back to BlackRock. Even though, again, the same corporations that BlackRock was helping to bailing out, were the same corporations they owned some of the biggest stakes in. And yet, despite all his considerable power, the general public has practically never heard of Larry Fink, with BlackRock barely coming into the public eye during the recent claims that they’re buying up single-family homes. That’s because Larry is smart – he’s intentionally kept it that way. He’s spent the last 33 years building BlackRock into the biggest asset manager in the world, with over $9 trillion dollars under their management.

And that’s just the tip of the iceberg. Learn more about the world’s largest “shadow bank.”

Watch:

Youtube VIDEO [includes pay-the-bills-ads]: BlackRock: The Company that Owns the World

[Posted by Jake Tran

Posted on 8/10/21

MORE DESCRIPTION]

READ MORE BlackRock NEWS AT: 21st Century Wire BlackRock Files

ACTIVIST POST – ALTERNATIVE INDEPENDENT NEWS – CREATIVE COMMONS 2019

ALLIGATOR SHOES – Blonde Joke


I haven’t read a Blonde Joke in quite some time. This a brought on a chuckle. My Internet Provider is working out kinks so things are running slow. This is me taking a mirth brake from political grouchiness.

JRH 12/9/22

Thank you to those who have stepped up!

READER SUPPORTED! I need Readers willing to chip in $5 – $10 – $25 – $50 – $100. PLEASE I need your generosity. PLEASE GIVE to Help me be a voice for Liberty:

Please Support SlantRight 2.0

YOU CAN ALSO SUPPORT via buying healthy supplements/products from Online stores (mine & my Honey):

My Store: https://modere.co/3SrOHzI

My Better Half’s Store: https://dianahouk.shiftingretail.com/  

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**********************

ALLIGATOR SHOES – Blonde Joke

Posted by Linda Kane-Norris

Posted 12/9/22

USA.Life Social Platform

A blonde was on vacation in the depths of Louisiana.
She wanted a pair of genuine alligator shoes but didn’t want to pay the high prices.


After unsuccessfully haggling with of one of the shopkeepers, the blonde said, “Maybe I’ll just go out and catch my own alligator, so I can get a pair of shoes at a reasonable price.”


Later in the day, the shopkeeper spotted the young woman standing waist-deep in the water, shotgun in hand.


She took aim at an alligator, killed it, and hauled it onto the swamp bank.
Lying nearby were several more of the dead creatures.


The shopkeeper watched in amazement as the blonde flipped the alligator on its back and shouted in frustration, “Damn, this one isn’t wearing any shoes either.”

Letter to the American Church – Chapter 1


As Christians we must shred calls to avoid politics. Without Christian faith in politics, moral values have been suppressed and nearly made illegal. This post provides a great picture for the reason Christians MUST be as vocal politically as they are for their Religious Liberty!

Thank you to those who have stepped up!

READER SUPPORTED! I need Readers willing to chip in $5 – $10 – $25 – $50 – $100. PLEASE I need your generosity. PLEASE GIVE to Help me be a voice for Liberty:

Please Support CPCR

YOU CAN ALSO SUPPORT via buying healthy supplements/products from Online stores (mine & my Honey):

Mine: https://modere.co/3SrOHzI

My Better Half: https://valentus.com/dianahouk

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**********************

Rev. Patti's avatarNo Thought Police

Chapter 1

What Is the Church?

“See, I have set before you today life and good, death and evil. If you obey the commandments of the Zlord your God that I command you today, by loving the lord your God, by walking in his ways, and by keeping his commandments and his statutes and his rules, then you shall live and multiply, and the Lord your God will bless you in the land that you are entering to take possession of it. But if your heart turns away, and you will not hear, but are drawn away to worship other gods and serve them, I declare to you today, that you shall surely perish. You shall not live long in the land that you are going over the Jordan to enter and possess. I call heaven and earth to witness against you today, that I have set before you life…

View original post 4,944 more words

Actual Science of mRNA Deaths & DNA Alterations


John R. Houk, Blog Editor

© February 28, 2022

I am not actually a science-oriented person. HOWEVER, I can read. Today I am sharing info from science oriented people. If you can refute the data with a science rebuttal that is not a simple fake Globalist-science admonition of “fake,” “false” – without the reason, “misinformation” by telling why without character assassination, and YOU GET THE IDEA; then I’d love to read the scientific refutation. If you cannot, I’ll just call you a Left-Wing lying propagandist trying to maintain Globalist-Marxist control of the population via fearmongering.

The first cross post is explanatory from the title: “Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years.”

The next two cross posts are related to the science-deep reporting of Igor Chudov on Substack. Those posts are full of links and diagrams to actual scientific studies that stretches my mind to comprehend but Chudov makes the effort to make the science comprehensible.

FIRST Chudov article: I’m using the NWO Report version because it’s simply easier to read than the Substack version was posted on 2/25/22: “Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA.”

SECOND Chudov article: Is from his Substack page: “DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene.”

JRH 2/28/22

I need your generosity. PLEASE GIVE to overcome research expenses:

Please Support NCCR

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**************************

Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years

By Brian Shilhavy Editor, Health Impact News

February 26, 2022

Vaccine Impact

Comparison VAERS Vaxx Data

The latest data dump into the U.S. Government’s Vaccine Adverse Events Reporting System (VAERS) happened yesterday (2/25/21) and covers data through 2/18/2022.

This data is supplied by the FDA and the CDC.

Since December of 2020, when the COVID-19 vaccines were issued emergency use authorization, there are now a recorded 1,134,984 cases of deaths and injuries.

1-Year-Data-Covid19-Vaccines

Source.

There are now more reported cases of injuries and deaths following COVID-19 vaccines for the past year than there were following all vaccines for the previous 30 years before the COVID-19 vaccines were authorized.

30+ Years Data Cases VAERS

Source.

And there are now almost twice as many deaths recorded following COVID-19 vaccines in its first year than there were recorded in the previous 30 years before the COVID-19 vaccines were introduced.

Why are we still doing this?

Here is the CDC’s response after publishing this data:

CDC (DECEPTIVE) response to Data

Comment on this article at HealthImpactNews.com.

See Also:

Rumble VIDEO: In Memoriam: Victims of COVID-19 “Vaccines”

[Posted by HealthImpactNews

Published August 2, 2021

There are no second chances after you take the shot(s) and your family and friends mourn you at your funeral.]

MORE Information on Page TO READ

Copyright 2022 Health Impact News 

Vaccine Impact HOME PAGE

+++++++++++++++++++++

Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA

Pfizer Jab

Posted by Nwo Report

Source: Igor Chudov

February 27, 2022

NWO Report

For over a year, our trusted “health experts and fact checkers” have been telling us that mRNA vaccines, including Pfizer and Moderna, do not integrate themselves into human cellular DNA. However, a bombshell new study published in Current Issues of Molecular Biology shows that the health experts and fact checkers were wrong.

Lab studies show that mRNA vaccines DO integrate themselves into human cellular DNA. In essence, the vaccines change your DNA forever.

Intracellular Reverse Transcription Pfizer

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

Mainstream media and fact checkers have dedicated themselves to telling us the opposite:

MSM Disinformation Lies

However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

IgorChudov reports:

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

Molecular Biology Abstract screen capture

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.

It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).

What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.

This process is called “transcription”.

For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.

To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.

Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

Transcribed DNA Seen NOT RNA

The genetic code that they picked up is:

  • CGAGGTGGCCAAGAATCTGAACGAGA
  • GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
  • TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
  • GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
  • TCGACGAGGACGATTCTGAGCCCGTGCTGA
  • AGGGCGTGAAACTGCACTACACATGATGAC
  • TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
  • GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
  • CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Anyone wants to run BLAST on it?

Simplified

As I explained in response to a questioner:

Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.

Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.

Cancer Code

Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.

Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.

Please repost this article far and wide due to its big implication for our public health.

EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?

mRNA and S Protein data

© 2022 NWO REPORT

++++++++++++++++++++

DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene

Having fun BLASTing DNA Reverse Transcribed from Pfizer Vax

By Igor Chudov

2/27/22

Igor’s Newsletter

My previous post about a science article proving that Pfizer mRNA vaccine reverse transcribes into human DNA, has garnered enormous interest and lots of comments, may of which were incredible.

If you did not read it yet, PLEASE READ IT FIRST before reading this article. Otherwise you may get lost and not even realize the significance of how your loved ones’ genetic code may have been reprogrammed. Here you go:

I decided to continue plodding along and see what else we can uncover, based on that “Current Issues in Molecular Biology” article:

Igor Newsletter- Reverse Transcription

The article contains a printout of genetic DNA code that was detected in human cell DNA materials reverse transcribed from the mRNA vaccine.

printout of genetic DNA code 

So, I decided to check what is actually in this code above, is that just harmless junk or something more ominous. For that, I ran a free NCBI “BLAST” tool by copying and pasting the above genetic sequence in it. This is the same BLAST tool that @JikkyKjj used to show a Moderna “cancer patent” sequence on the most important, “furin cleavage site” of Sars-Cov-2. I wrote about that also:

Anyway, impressed with @JikkyKjj’s discovery, I decided to do the same with the DNA code that Pfizer mRNA vaccine generates (reverse transcribes) into human cells. Turns out that I was the first to enter that sequence into the NCBI BLAST tool (because it took a while to analyze) and it now has a sequence ID of 1R3ZDZJY016.

And here are the results. I annotated them to make it easier for you to see what is and is not interesting.

Igor Annotations

The first few results are from the usual suspects such as chimeric viruses, Sars-Cov-2 sequences, etc. It is understandable why we should ignore them — the chimeric viruses are pure lab constructs of unknown significance, and Sars-Cov-2 sequences are obviously there because the vaccine encodes Sars-Cov-2 spike protein. Those are “expected matches”.

What is interesting — and I am not saying it is the only thing — is the gp130 glycoprotein gene that is 97% similar to the human gp130 glycoprotein gene. The chance of that being a random coincidence, per BLAST tool, is 0.000000000000000000000000000000000000000000000000000000000002.

I clicked on it:

Red Dots Show gp130 Mutations

You can click on the “Gene” link to see what that gp130 gene is about:

TLE family member 5

Where this gene is used

So, we have Pfizer Covid mRNA vaccine reverse transcribe to a MUTATED gp130 gene. Remember the 97% match? The 3% non-matches, the four red dots, are the mutations of the gp130 gene.

So, without looking at these specific mutations, what happens when gp130 gene mutates in general? Nothing good comes up and you can search for it too.

Liver Cancer focus

Please note that a question arises: gp130 mutations can cause liver tumor, and the entire experiment was performed on a line of immortal liver cancer cells. Could it be that the original article picked up mutated gp130 from the Huh7 liver cancer cells? If that is the case, if the DNA sequence is inherent to Huh7 line itself, it could invalidate a lot of conclusions that the original science article, as well as my own articles, were making.

However, the authors were diligent with controls and did NOT see the questioned DNA sequence that I am looking at, in the control cells that did NOT receive the Pfizer vaccine. In addition, the published DNA sequence contained Sars-Cov-2 genes (see BLAST results), so it does come from the effect of the vaccine, not the Huh7 culture cells.

No DNA in Controls

I did perform some cursory checks, to the best of my ability, and the Huh7 line contains p53 mutations, but it does not seem like it contains gp130 mutations.

So, keeping my fingers crossed, the mutated gp130 gene that I found, is a genuine finding of lab research, comes from the mRNA vaccine, and not a coincidental pickup from the Huh7 cells.

I am guessing that the authors were looking at liver cells specifically, because they knew where to look (that the mRNA delivery system delivers the lipid nanoparticles to the liver). Why did the authors pick liver cells? Maybe because they heard of this 4chan post from 2020, when NOTHING yet was known about the strange mRNA vaccines:

mRNA Mostly Ends Up in Liver

[Blog Editor: I’ve noticed Nwo Report authors have spliced some of the photo arrays from this point in their post above. If you choose to read it at the Igor Newsletter Substack go HERE.]

© 2022 Igor Chudov

The Third Doctors for Covid Ethics’ Symposium (18 February 2022)


Doctors & Science not dominated by Globalist-control double-speak lies! https://johnplatinumgoss.com/2022/02/20/the-third-doctors-for-covid-ethics-symposium-18-february-2022/

johnplatinumgoss's avatarAll the Goss

On a day when world experts from the medical, scientific, legal and financial sectors brought knowledge, insight and hope to the world, Bill Gates was still riding the vaccine waggon from which the wheels long ago came off. Gates’ latest message is just more of the same with a statement that is as ludicrous as it is false.

“Sadly, the virus itself – particularly the variant called Omicron – is a type of vaccine. That is, it creates both B-cell and T-cell immunity, and it’s done a better job of getting out to the world population than we have with vaccines. . .”

Bill Gates at the Munich Security Conference, 18 February 2022

Had he said that the body’s immune system was a better defence than any vaccine he would have been much closer to the truth. That message is something that Sucharit Bhakdi has been saying for two years…

View original post 2,709 more words

Vaccine Cult Exposed by Government’s Own Data…


The DOCUMENTED data is official. VAERS show adverse reactions from COVID-Jab in the last 11-months than all the rest (legit non-mRNA) vaccine adverse reactions the last 30-years. AND WE ARE STILL told the LIE mRNA Jabs are safe and effective with one-time Free-World imposing tyrannical Jab mandates.

JRH 12/2/21

I need your generosity in 2021 PLEASE GIVE via – credit cards, check cards & debit cards are accepted by my PayPal account:

Please Support NCCR

Or if not donating you can support by getting in the Coffee from home business earning yourself extra cash – OR just buy some TASTE GOOD healthy coffee, that includes immune boosting products. Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

***********************

Vaccine Cult Exposed by Government’s Own Data: More than 50% of ALL Vaccine Adverse Reactions Reported for Past 30+ Years Have Occurred in Past 11 Months Following COVID-19 Shots

VAERS-Vaxx Graph. All Vaxes 30 yrs. vs COVID-Jab last 11 Months

By Brian Shilhavy Editor, Health Impact News

November 30, 2021

Vaccine Impact

The latest data dump into the U.S. Government’s Vaccine Adverse Events Reporting System (VAERS) happened late yesterday afternoon (11/29/21) and covers data through 11/19/21.

The VAERS database was mandated by Congress over 30 years ago, beginning in 1990, and is maintained by the U.S. CDC and FDA.

As of yesterday’s update, there are now a total of 1,765,262 cases of adverse events following all vaccines for the past 30+ years, including the experimental COVID-19 shots that have been issued emergency use authorization and are not yet approved by the FDA (source).

(Note: The FDA did approve one of the Pfizer shots, but the one they approved is not in circulation within the U.S. at this time.)

Of those 1,765,262 cases of adverse events following all vaccines for the past 30+ years, 913,268 of them (52%) have been reported during the past 11 months following COVID-19 shots (source).

68% of ALL Recorded Deaths Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 28,379 deaths recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

68% of those deaths, 19,249, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

61% of ALL Recorded Life Threatening Events Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 35,524 life threatening events recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

61% of those life threatening events, 21,582, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

60% of ALL Recorded Permanent Disabilities Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 51,231 permanent disabilities recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

60% of those permanent disabilities, 30,967, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

55% of ALL Recorded Hospitalizations Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 178,383 hospitalizations recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

55% of those hospitalizations, 97,561, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

20% of ALL Recorded ER Visits Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 507,064 ER visits recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

20% of those ER visits, 101,373, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

(Note: It is well-reported that there have been a shortage of hospital workers this year, with some ERs even closing completely, so it is very likely that this percentage of ER visits following COVID-19 shots would be even higher if the nation’s hospitals were working at full staffing as in past years.)

Conclusion: The Government’s own Data Show that COVID-19 Experimental Shots are NOT Safe!

After reviewing this data supplied by the U.S. Government, how can anyone conclude that the experimental COVID-19 shots are safe?

With all the boosters being rolled out now, one might be tempted to think that there have been exponentially more COVID-19 shots administered than in previous years to account for these large numbers.

But we are talking about 11 months of data for ONE single class of “vaccine” compared to ALL vaccines for the past 30+ years!

It would probably take considerable time to research how many doses of every kind of vaccine have been distributed for the past 30+ years since 1990, but we do have totals supplied by the CDC for one of the classes of vaccines, the annual flu shot.

According to the CDC, from 1990 through 2021, there have been over 3 billion flu shots (3,104,500,000) distributed in the U.S. (Source.) The 2020-2021 flu season alone distributed about 194 million flu doses. (Source.)

In comparison, according to the CDC, for the three currently authorized COVID-19 shots, there have been 459 million doses distributed in the U.S. through November 30, 2021. (Source.)

So just for one vaccine, the flu shot, there have been 6X more shots given for the past 30+ years, and that does not include the many dozens of other vaccines given over the past 30+ years, mostly to children.

These COVID-19 shots are not safe. They are deadly.

And when we discuss children, this whole vaccination eugenics program turns very dark, and very evil.

All Vax Deaths by Age for 30 yrs.

When we search for all the recorded deaths following FDA-approved vaccines for the past 30+ years, about 50% of those deaths have been recorded for children under the age of 3. (Source.)

The COVID-19 EUA shots have not yet been approved for this age group, although Moderna and Pfizer are currently conducting trials on children between the ages of 6 months old and 4 years old, and Anthony Fauci has promised us that these shots will be authorized for this age group after the first of the year (2022).

So while 68% of ALL deaths following injections have occurred in the past 11 months following COVID-19 shots, 19,249, only 4 of those deaths have been recorded so far in children under the age of 3. (Source.)

One of those cases appears to be an error (death by suicide; 12/26/20, self-inflicted gunshot wound), one was a “5 month old breastfed infant,” one was a fetal death in the first trimester, and the other one may be a death from the Moderna COVID-19 vaccine trials for this age group, where the infant had a seizure.

What are these numbers going to look like when they start injecting these fragile babies with these killer COVID-19 shots?

Well, given how many unborn children are dying in the womb of their pregnant mother who received one of these shots, and the historical data that young children are the most susceptible to deaths following vaccination, we should literally expect a massacre.

2732-fetal-deaths following COVID Jab

From the data released into VAERS yesterday, we have found 2,732 fetal deaths, which includes ectopic pregnancies, which is when a fertilized egg grows outside a woman’s uterus, and then the fetus has to be surgically or chemically removed. (Source.)

We have previously reported that ectopic pregnancies following COVID-19 shots have been reported at 50 X more than reported following ALL vaccines for the past 30+ years. See:

VAERS Data Reveals 50 X More Ectopic Pregnancies Following COVID Shots than Following ALL Vaccines for Past 30 Years

Using this same exact search in VAERS to determine fetal deaths following COVID-19 shots for the past 11 months, which found 2,732 fetal deaths, we applied it to ALL vaccines that are non-COVID for the past 30+ years, and it returned 2,163 deaths. (Source.)

That’s an average of about 72 fetal deaths per year following all FDA-approved vaccines for the past 30+ years, compared to what is on pace to be 2980 fetal deaths in 1 year following COVID-19 shots.

  • FDA-approved vaccines: 72 fetal deaths per year
  • COVID-19 EUA shots: 2980 fetal deaths per year

Here is a screen shot from a Social Media thread just recently posted.

twitter-fetal-deaths screen shot

Here is a video we produced in October showing some of the effects of these shots on unborn children.

Rumble VIDEO: 1,969 Fetal Deaths Recorded Following COVID-19 Shots – Criminal CDC Recommends Pregnant Women Get It

[Posted by HealthImpactNews 

Published October 1, 2021

The CDC released more data today into VAERS (Vaccine Adverse Event Reporting System) which shows that there are now 1,969 fetal deaths among pregnant women who received a COVID-19 shot.

By way of contrast, I performed the exact same search in VAERS for all non-COVID-19 vaccines for the past 30 years, and it returned a result of 2,183 fetal deaths from pregnant women following vaccination for the past 30 years.

So there have been nearly the same amount of fetal deaths following COVID-19 shots during the past 10 months, as there have been for the past 30+ years that VAERS has been in existence!

And how has the CDC responded to this data?

This past week the CDC published recommendations for all pregnant women to get a COVID-19 shot!

Full story >>> https://healthimpactnews.com/2021/1969-fetal-deaths-recorded-following-covid-19-shots-but-criminal-fda-and-cdc-recommend-pregnant-women-get-the-shot/]

This is Not About Science or Public Health – This is a Religious-like Vaccine Cult

Praying to Cult of Jab

Faced with this data that comes directly from the U.S. Government’s own VAERS database, which is vastly under-reported as so many medical professionals have now come forward as whistleblowers to reveal how much pressure is being put on them NOT to report these deaths injuries to VAERS (Watch: COVID Vaccine Injuries & Deaths COVER-UP! Nurse Whistleblowers Speak Out on Pressure to NOT Report), why are people still lining up to get these killer shots, and even worse, allowing their children to be injected with them?

We only covered the U.S. Government data in this article so far showing that these experimental shots are very clearly dangerous, but not only are they killer shots, they also don’t work for the main purpose that people have been convinced to take them: to stop the spread of COVID-19 so we can all return to a “normal life.”

This is biggest lie that the pharma-owned corporate media has broadcast to the public, as we have a record of WHO director Tedros Adhanom recently telling Brazilian President Jair Bolsonaro that the vaccines are not even designed to stop transmission, only to prevent serious illness and death. See:

Brazilian President tells WHO Director “People are Dying” After COVID Shots – Pleads with WHO to Publicly NOT Recommend it for Children

Even Bill Gates stated in a recent interview that “we need a new way of doing the vaccines” because they don’t do a good job of stopping transmission. See:

Bill Gates: mRNA Vaccines Don’t Stop Transmission – We Need a New Way of Doing Vaccines

And according to official public data, COVID deaths in 2021 after almost a half billion doses of COVID-19 EUA shots are HIGHER than 2020 COVID deaths when there was no COVID-19 “vaccine.”

U.S. COVID Deaths Graph 2020-21

Source.

And yet, now that we are almost 1 year into the experimental “vaccines,” and we have all this data to show that they are neither safe nor effective, if you present this data to those who are still pro-COVID-19 “vaccines,” it will not convince most of them.

It is a political and ideological issue to them, the facts be damned.

This is the classic definition of a “cult.”

I prefer to use “The Free Dictionary” to look up definitions of English words as opposed to the Merriam Webster dictionary, which is owned by a Jewish Swiss financier, and has changed the definition of “vaccine” several times this year, and even recently named “vaccine” as “Top Word of the Year.” (Source.)

See:

The Evolving Definition of “Vaccine” in the Merriam-Webster Dictionary for 2021

The Free Dictionary website, which uses the more traditional “American Heritage Dictionary,” defines “cult” as:

cult (kŭlt)
n.
1. a. A religion or religious sect generally considered to be extremist or false, with its followers often living in an unconventional manner under the guidance of an authoritarian, charismatic leader.
b. The followers of such a religion or sect.

2. A system or community of religious worship and ritual.

3. The formal means of expressing religious reverence; religious ceremony and ritual.

4. A usually nonscientific method or regimen claimed by its originator to have exclusive or exceptional power in curing a particular disease.

5. a. Obsessive, especially faddish, devotion to or veneration for a person, principle, or thing.
b. The object of such devotion.

6. An exclusive group of persons sharing an esoteric, usually artistic or intellectual interest.

Cult members are usually referred to as “deceived” and “brain washed.”

This is clearly what we are dealing with today, all in the name of “science.”

The Bible refers to it as a “delusion.”

The coming of the lawless one will be in accordance with the work of Satan displayed in all kinds of counterfeit miracles, signs and wonders, and in every sort of evil that deceives those who are perishing.

They perish because they refused to love the truth and so be saved. For this reason God sends them a powerful delusion so that they will believe the lie and so that all will be condemned who have not believed the truth but have delighted in wickedness. (2 Thessalonians 2:9-12)

ADDITIONAL INFO

Copyright 2021 Health Impact News

Vaccine Impact HOMEPAGE