user avatar
Andrew Steele
@statto
Longevity scientist / Author of ageless.link / Presenter youtube.com/DrAndrewSteele / Co-Founder and Director @longevityinit
Berlin, DE
Joined May 2007
  • Pinned
    user avatar
    Ageless: The new science of getting older without getting old is out in paperback! ‘A tour de force of anti-ageing science’ – @thetimes ‘A fascinating look at how scientists are working to treat the aging process itself’ – @drsanjaygupta Buy a copy at andrewsteele.co.uk/ageless/
    Ageless UK paperback cover: a twist on the tortoise and the hare, with the tortoise strapped to an assistive rocket!
    Ageless US paperback cover: a rather elegant-looking fish
  • user avatar
    ‘2022 UK Government crisis’ now needs disambiguating on Wikipedia.
    Screenshot of Wikipedia page:

# 2022 United Kingdom government crisis

This article is about the mass resignation of ministers from the Johnson government in July 2022. For the Truss government crisis resulting from the September 2022 mini-budget, see September 2022 United Kingdom mini-budget.
  • user avatar
    Replying to @ZonePhysics
    This isn’t correct. * This isn’t laminar flow, which is smooth by definition * It’s actually something else cool—syncing camera frame rate with a wobble applied to the tap, like this youtube.com/watch?v=mODqQv…—so there’s no need to misstate it to make it seem cooler
  • user avatar
    There is more to rainbows than the human eye can see: here is how a rainbow extends into the infrared and ultraviolet. Photos: ultraviolet, visible (obviously), infrared, and a composite showing how UV is beyond the violet in a rainbow, and IR beyond the red end.
  • user avatar
    This is a graph of what people think will help with climate change versus the actual impacts. By skewing perceptions so massively, I think the war on plastic packaging has been a disaster. Graph via linkedin.com/pulse/what-red…
    22% of people think that cutting back on plastic bag use is the most significant way to reduce their CO₂ emissions…more than any other suggestion. Meanwhile, only 10% think no more meat consumption will help…in spite of it actually being something like 250 times more effective.
  • user avatar
    You can fit the whole #coronavirus genetic code on a single side of a single sheet of A4 paper.
    Photo of a piece of A4 paper, with text reading:

SARS-CoV-2.0 (classic covid)
AUUAAAGGUUUAUACCUUCCCAGGUAACAAACCAACCAACUUUCGAUCUCUUGUAGAUCUGUUCUCUAAACGAACUUUAAAAUCUGUGUGGCUGUCACUCGGCUGCAUGCUUAGUGCACUCACGCAGUAUAAUUAAUAACUAAUUACUGUCGUUGACAGGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGC … skip a few because of Twitter alt text character limit! … GUACGAUCGAGUGUACAGUGAACAAUGCUAGGGAGAGCUGCCUAUAUGGAAGAGCCCUAAUGUGUAAAAUUAAUUUUAGUAGUGCUAUCCCCAUGUGAUUUUAAUAGCUUCUUAGGAGAAUGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  • user avatar
    It’s #TransitofMercury time again! From 12:35 UTC (so in about half an hour) until 18:04 UTC (so after sunset for us in the UK!), tiny Mercury will be working its way across the face of the Sun. Here’s a picture I took last time it happened, on May 9th 2016.
    A big white circle (the Sun) with a tiny black dot (Mercury) in front of it
  • user avatar
    It feels like everyone I know has covid at the moment. Is there any point trying to stop it, or should we just stop isolating and learn to live with the virus? I made a two-minute video explainer:
    00:00
  • user avatar
    This is gallium, not mercury. 1200 retweets so far, and not only is it factually wrong but it suggests playing with a highly toxic element with your bare hands. This is dangerous, @ZonePhysics. Take it down.
  • user avatar
    .@Conservatives have ‘announced plans to design, develop and build…a commercially viable fusion power plant by 2040.’ For, er, <checks notes> £200 million! Funding for fusion is good news, but this is so ridiculous as to be a simple lie. press.conservatives.com/post/188017980…
  • user avatar
    More exciting health news! An mRNA vaccine, like the covid jabs, has been used to train patients’ immune systems to destroy their cancer…and it seems to have worked! Just a press release so far, and a small study, but exciting results!
  • user avatar
    Hahaha, someone has suspended balloons over the floor vents at @TheCrick
    00:00
  • user avatar
    2500 retweets. Let’s take a look at what this guy is claiming. Has Bryan really become five years younger in a matter of months? And does his strategy make sense? THREAD
    Bryan Johnson sold his company to PayPal for $800 million in 2013. Since then, he's been investing millions to reduce aging. In 2021, he reduced his epigenetic age by 5.1 years in 7 months (World Record) Here’s a breakdown of his “Blueprint” and my own experience with it: 🧵
  • user avatar
    I couldn’t find the graph I wanted to work out how worried to be about coronavirus hospitalisations, so I made it. It hasn’t really changed my opinion—I’m unsure, and still a bit worried—but at least I have a graph now!
    Graph of coronavirus cases and hospitalisations in the UK. Caption:

Hospitalisations due to coronavirus tend to follow cases after a delay, because it takes time for people to get sick enough to need to go to hospital. So, if we plot…
…cases (7-day rolling average)…
…and hospitalisations (assuming 8% of cases end up in hospital 10 days after testing positive)
The lines follow one-another quite well. Until…
This gap [between the cases and offset hospitalisations line] shows us that fewer cases are turning into hospitalisations, because those most at risk are protected by vaccination. Great news!
But…we need to watch this hospitalisation line, because it’s still rising with cases, even if the relationship isn’t as strong as it was in the past…
And the increase in cases doesn’t show much sign of slowing down. If it doesn’t, hospitalisations will catch up eventually…