user avatar
Ensembl
@ensembl
The Ensembl project seeks to enable genomic science by providing high quality, integrated annotation.
Hinxton, UK
Joined February 2009
Posts
  • Pinned
    user avatar
    Ensembl 116 + Ensembl Genomes 63 are out! Explore new pig, cattle, and oat genomes, updated alignments and new VEP plugins It’s a milestone! Our last on the current platform. New data from here on is via beta.ensembl.org More info on our blog: zurl.co/MrJ2A
  • user avatar
    ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at @ensembl
  • user avatar
    ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at Ensembl! buff.ly/1Izo5qL
  • user avatar
    1/ You’ve sequenced your samples and identified variants. Great! 🙌 Now, here's how you can use @ensembl to find out the effect of your variants on #protein structures and interactions. A thread...🧵 #genomics #bioinformatics #tweetorial #Ensembltraining 🧬
    A screenshot from Ensembl's Alphafold protein viewer with variant 'rs1263298508' highlighted in magenta on the protein structure
  • user avatar
    1/ My favourite gene has 15 transcripts, which one should I use for further analysis? To report the position of variants? To design primers for? 🤯 This #tweetorial will show you how to filter and prioritise transcripts… 🧵 #genomics #bioinformatics #Ensembltraining 🧬
    Screenshot of the transcript table of the LAMA3 gene in the Ensembl genome browser
  • user avatar
    1/ Do you need to download sequences from #Ensembl? We’ve put together a #tweetorial to guide you in the right direction whether you need the sequence for a single exon or a whole #genome… 🧵 #genomics #bioinformatics #Ensembltraining 🧬
  • user avatar
    1/ Want to learn about a gene, but there’s no functional data for that species? Or maybe you're looking for a homologue of your favourite gene in a model organism? Here's how you can find orthologues in @ensembl. A thread…🧵 #genomics #bioinformatics #Ensembltraining🧬
    Tree of species represented in Ensembl
  • user avatar
    Hip hip, hooray! Ensembl is 22 years old! 🎉🥳🎊🍾🎁🎈🎂 Here's a baby pic of 6 months old @ensembl 👶 look how far we've come. #genomics #bioinformatics
  • user avatar
    1/ Do you want to get the promoter sequence of your favourite gene from @ensembl? The answer might be more complicated than you first thought, but we’re here to walk you through it. A thread...🧵 #genomics #bioinformatics #epigenomics #epigenetics #tweetorial #Ensembltraining🧬
    Screenshot of the Ensembl genome browser showing 4 transcripts of the KPNA2 gene, with exons and introns represented as lines and boxes. There is an additional genomic feature, a promoter, represented as a red box.
  • user avatar
    Want to learn about a gene function, but there’s no functional data in your species of interest? Or maybe looking for a homologue of your fav gene in a model organism to carry out functional work? Look no further! This #tweetorial will show you how to find orthologues in @ensembl
  • user avatar
    1/ Do you want to know if a variant will affect the structure and function of a protein? We’ve got lots of tools and #data in @ensembl to help you investigate and we’re here to show you how! A thread...🧵 #genomics #bioinformatics # #tweetorial #Ensembltraining🧬
    Screenshot of protein structure viewer in Ensembl showing alpha-helical structure with highlighted amino acid residue at variant position
  • user avatar
    1/ Do you want to get the promoter sequence of your favourite gene from @ensembl? The answer might be more complicated than you first thought, but we’re here to walk you through it. A thread...🧵 #genomics #bioinformatics #epigenomics #epigenetics #tweetorial #Ensembltraining🧬
  • user avatar
    ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at @ensembl
  • user avatar
    1/ Do you need reference sequence files from #Ensembl? All of the different files available can be confusing. Here’s a thread to help you decide which files you need…🧵 #genomics #bioinformatics #tweetorial #Ensembltraining🧬