Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Oct 6.
Published in final edited form as: J Chem Inf Model. 2021 Aug 26;61(9):4139–4144. doi: 10.1021/acs.jcim.1c00696

E2EDNA: Simulation Protocol for DNA Aptamers with Ligands

Michael Kilgour 1, Tao Liu 1, Brandon D Walker 2, Pengyu Ren 2, Lena Simine 1,*
PMCID: PMC9536994  NIHMSID: NIHMS1840055  PMID: 34435773

Abstract

We present the E2EDNA simulation protocol and accompanying code for the molecular biophysics and materials science communities. This protocol is both easy to use and sufficiently efficient to simulate single-stranded (ss)DNA and small analyte systems that are central to cellular processes and to nanotechnologies such as DNA aptamer-based sensors. Existing computational tools used for aptamer design focus on cost-effective secondary structure prediction and motif analysis in the large datasets produced by SELEX experiments. As a rule, they do not offer flexibility with respect to the choice of the theoretical engine or a direct access to the simulation. Practical aptamer optimization often requires higher accuracy predictions for only a small subset of sequences suggested e.g., by SELEX experiments, but in the absence of a streamlined procedure this task is extremely time and expertise intensive. We address this gap by introducing E2EDNA, a computational framework powered by Tinker, POLTYPE, MacroMoleculeBuilder and NUPACK that accepts a DNA sequence in the FASTA format and the chemical structures of the desired ligands in the sdf format as inputs and performs approximate folding followed by a refining step, docking, and molecular dynamics sampling at the desired level of accuracy. As a case study we simulate a DNA-UTP (Uridine TriPhosphate) complex in water using the state-of-the-art AMOEBA polarizable force field, beginning with identifying a representative 3D structure of the aptamer at experimental conditions, and then assessing the binding affinity of UTP.

1. Introduction

DNA aptamers are short (~10-100 residues) single-stranded nucleotide (ssDNA) sequences. One popular use for DNA aptamers is as sensors or ‘aptasensors’ for a wide variety of molecular ligands including antibiotics[1], neurotransmitters[2,3], metals[4], proteins[5], nucleosides, including most famously ATP [6,7], and other small molecules [810]. The advantage of aptasensors that makes them particularly attractive is the demonstrated potential for stable and selective sensing in crowded biochemical environments, e.g., in blood or in polluted water. The difficulty lies in designing sequences which reliably and selectively bind a desired target analyte. Promising aptasensor candidates are selected using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) protocol which iteratively enriches DNA libraries with sequences exhibiting preferential affinity toward a target ligand. The candidate aptasensors identified by SELEX contain sequences that are promising but often far from optimal for real-life applications. The key to improving them lies in identifying the causal relationship between sequence and sensing performance. This relationship depends primarily on the 3D folded structure of the aptamer and the structural rearrangements that may be caused by the binding of a ligand of interest.

Several powerful computational frameworks were initially developed for the study of protein-RNA structure and binding [11], with many basic tools carrying over to the study of DNA aptamers and combining with entirely new approaches. For example, APTANI and APTANI2[12] are two methods for selecting potentially relevant aptamers from SELEX datasets through a sequence-structure analysis. Both tools contain modules to predict specific secondary structures in each selection round and to rank aptamers by motifs embedded in their predicted structures. AEGIS, a platform for aptamer design, combines fully automated SELEX experiments with computational structural characterization for efficient discovery of new aptasensors for disease targets. Aptamer structural prediction with AEGIS is carried out using a novel deep learning approach: a generative adversarial network trained on structure predictions following the ViennaRNA/Rosetta powered iGEM aptamer analysis protocol [1315], which guesses the possible secondary structures of a transcripted RNA strand, before converting to DNA and making a final prediction.

Computational analyses of this type are very sensitive to the underlying physical models which predict the folded structure of the aptamer and the response to the presence of a ligand. Our goal in this paper is to present a high-accuracy computational pipeline from sequence to bound aptamer-analyte complex that may be used to inform aptamer design efforts, including automated in-silico design platforms. The capability of our E2EDNA design protocol does not hinge on any particular or assumed model. Where E2EDNA takes input from such models, such as in the prediction of aptamer secondary structure, we directly test their predictions using explicit, all-atom, explicit water molecular dynamics simulations, using appropriate high-accuracy force fields.

The paper is structured as follows: In Section 2, we present our modular computational framework. We then demonstrate its use with a case study characterization of a given aptamer structure and its binding to a charged uridine triphosphate (UTP) molecule in water, along with detailed analysis in Section 3. We conclude the paper with a summary and an outlook in Section 4.

2. E2EDNA Protocol

E2EDNA (End-to-end-DNA) allows for prediction of the structure of a given aptamer and its binding affinity for a given target molecule or ‘analyte’. Beginning from basic information – the aptamer FASTA sequence, and the structure of the analyte – the E2EDNA protocol includes any necessary analyte parameterization, 2D and 3D aptamer structure prediction and evaluation, and analyte binding analysis.

2.1. Pipeline Outline

Figure 1 graphically illustrates the steps of our end-to-end protocol. One begins with the DNA sequence one wishes to test against a given analyte, in FASTA format. The pipeline uses a secondary structure prediction tool to predict the most likely base-pairing motifs at the experimentally relevant temperature and ionic strength. A folding tool takes the sequence and list of bases to be paired, and, using strong fictitious forces and an inexpensive force field, pulls the sequence from a fully extended conformation into one which satisfies the given base pairing conditions, which is a rough prediction for the 3D structure.

Figure 1:

Figure 1:

Schematic of the E2EDNA end-to-end aptamer-analyte binding pipeline for UTP complexing with a very simple hairpin.

In general, secondary structure prediction tools cannot always identify with high confidence the complete aptamer structure at a given condition. Further, even an accurate secondary structure prediction necessarily misses key details of the 3D conformation of the aptamer. E2EDNA evaluates the quality of the proposed configuration or configurations and makes a final prediction via high-accuracy all-atom molecular dynamics simulation, with an example discussed in Section 3.1. Once a consensus 3D structure is discovered, the folded aptamer is complexed with the analyte and sampled via molecular dynamics simulation to determine binding affinity. Analysis of analyte binding to the aptamer, and any influence the analyte may have on aptamer structural reorganization is then carried out by comparison of complexed and free aptamer trajectories.

2.2. Pipeline Components

2.2.1. Parameterization

One step which may be required before running E2EDNA is force field parameterization. Depending on the analyte under study, one may require novel force field parameters, not already found in the literature. In the case of the polarizable AMOEBA force field which we employ here, one may generate parameters using the automated parameterization tool, POLTYPE[16], or its successor POLTYPE 2. POLTYPE is an open-source program, which was recently used e.g., to parameterize a variety of charged nucleosides[17]. With only an input structure, POLTYPE outputs a structure and accompanying quantum mechanically fit AMOEBA parameters, ready for simulation on the Tinker molecular dynamics platform.

POLTYPE 2 has made some improvements over the original POLTYPE in torsion and van der Waals parameterization. To achieve faster and more accurate parameterization, a fragmenter is implemented to derive torsion parameters. Bulky molecules often have steric interactions while sampling the conformational surface that lead to artificial barriers on the dihedral energy surface. Thus, fragmenting is important for accurately fitting torsion parameters. The fragmenter will start with a minimal fragment containing the atoms a-b-c-d plus neighbors of atoms, while not cutting any aromatic ring systems. The fragment will keep growing until a convergence criterion is met. That criteria being either hitting a maximum number of growth steps or relative Wiberg Bond Order between fragment and parent. Each fragment molecule follows the original POLTYPE procedure to derive multipoles, and torsion parameters from a rigid dihedral scan. Parameters from fragments are transferred back to the parent molecule.

If implementing this pipeline with a different MD platform or force-field, the parameterization tool would change accordingly, and similar utilities such as CGenFF and AmberTools Paramfit exist for the popular CHARMM and AMBER force fields respectively [18,19]. It is worth noting now that the MD platform, force-field, and virtually all other the individual components of the E2EDNA are modular; they could each be easily replaced if e.g., one desires e.g., a less expensive force field, or a different structure prediction protocol.

2.2.2. Secondary Structure Prediction

A crucial difficulty in aptamer-analyte binding analysis is the pre-folding of the aptamer to the correct equilibrium structure. In general, a single DNA sequence may adopt a very wide array of folded structures [20], and brute force approaches such as naïve molecular dynamics search are prohibitively computationally expensive.

Despite decades of work on this problem, due to the complexity of the underlying physical system, secondary structure prediction is not always possible with high confidence with existing tools. Indeed, in sequences with length exceeding a few dozen bases, de novo prediction without experimental input becomes extremely difficult, as the number of possible stable structures may become large, and possible structures may be difficult to discriminate [11]. Common software packages approach this issue by issuing an ensemble of predicted structures with associated probabilities, when appropriate, or by adding base-by-base pairing probabilities to overall structure predictions. One may also solicit predictions from various packages which each employ different numerical methods such as template-based models, fragment assembly, and minimization of empirical potentials [11].

E2EDNA leverages such purpose-built models to a-priori predict a structure or set of structures a given aptamer has a realistic probability of adopting, before analyzing and refining down to a final structural prediction. In the absence of experimental data, we assess the quality of predicted structures via molecular dynamics simulation with an appropriate force-field, similar to approaches which have been used in RNA structure evaluation[21]. MD sampling then allows us to compare the stability of proposed structures on the nanosecond-microsecond timescale.

In our E2EDNA implementation, we primarily use the ‘NUPACK’ and ‘seqfold’ Python packages for secondary structure prediction [22], which implement a range of modern empirical energy models to identify the minimum free energy structure at a given temperature and ionic strength. Both are remarkably fast and easy-to-use, with straightforward I/O and highly useful utility functions. One has only to supply the sequence FASTA string and associated simulation conditions.

2.2.3. 3D Structure Prediction

Given a proposed aptamer secondary structure in the form of a list of paired bases, we perform a directed simulation to fold it from an extended initial condition into the prescribed secondary structure. For this task, we use the program, MacroMoleculeBuilder (MMB) [23], which folds the structure through inexpensive simulation, with user-scalable attractive fictitious forces between the paired bases. Using such a tool, we can fold from an arbitrary DNA sequence to a 3D structure which agrees with the predicted secondary structure in a matter of minutes.

Depending on the size and complexity of a given aptamer structure, a customized user-specified annealing schedule may be required. In the SI we supply a script with a robust protocol which is efficient even for multi-hairpin structures exceeding 60 bases in length, along with a script which automatically generates MMB input files from secondary structure and sequence information.

Given the strong fictitious forces used to fold the structure in MMB, the output of this simulation is only a rough prediction of the aptamer 3D structure, which is analyzed and refined by subsequent MD simulation. Beyond refining the details, extended MD sampling is also used to verify the stability of a predicted secondary structure. For this refinement, we use the MD protocol detailed in Section 2.2.5.

2.2.4. Docking Site Prediction

Once a suitable representative 3D aptamer structure has been isolated, before binding analysis, one must complex the aptamer with the analyte. As in the case of structure of the aptamer itself, it is generally wasteful to randomly initialize the DNA and analyte initial positions, and search for an appropriate binding configuration by exhaustive molecular dynamics sampling. Instead, we a-priori predict one or more possible binding configurations and use these as the initial condition for binding trajectories. This prediction is made according to some docking protocol, which suggests likely analyte positions binding orientations, from which we initiate our sampling trajectories. Such a protocol could take the form of a docking program which predicts a set of likely binding sites using conformational and/or electrostatic features [2429].

For sequences sampled from an experimentally obtained distribution of sequences that bind a particular analyte, a data driven approach may be taken [28,29], which takes as inputs a selection of aptamer sequences from a SELEX run on the target analyte. From such a procedure, we identify certain bases whose mutation is likely to be important for determining aptamer-analyte binding efficiency, and therefore sites where it may be profitable to attempt to dock the analyte molecule.

2.2.5. Molecular Dynamics Sampling

Given a set of likely docking configurations between the analyte and folded aptamer, we sample the complex via molecular dynamics simulation. We generate trajectories with and without the analyte and compare the equilibrium probability densities along a series of user-identified reaction coordinates, with the difference between complexed and free aptamer equilibria determining the influence/affinity of the analyte with the aptamer. The same simulation and analysis protocols enable us to analyze and evaluate aptamer 3D structures, in the absence of the analyte.

In order to accurately capture the nuanced dynamics of the high charge of the analyte in our test case (see Section 3), we employ the advanced electrostatic and polarizable force field, AMOEBA[30]. We used the Tinker9 software suite running on Compute Canada NVIDIA V100 GPUs for the bulk of our simulations, as well as for simulation setup and post-processing. Detailed simulation parameters, derived from POLTYPE 2, in the form of Tinker keyfiles are given in the SI.

2.2.6. Binding Analysis

To assess the influence of analyte binding to the aptamer, we track the time evolution of user-specified reaction coordinates, identified by observing the dynamics of free and complexed aptamers. In the test case examined in Section 3, these coordinates describe base-pairing, large-scale structural rearrangements, and the distance from the analyte to predicted binding sites. Given sufficient sampling time we may compute the equilibrium density, P(r), and accompanying free energy profile, F(r) along the reaction coordinate and interrogate the stability of the folded structure and the influence of the analyte on the aptamer complex.

The free energy profile, as a function of the reaction coordinate distance, is given by,

F(r)=kTlnP(r). Equation 1

The probability distribution P(r) is computed via histogram of time-series analysis of the relevant reaction coordinates r, which are tracked using the Python package, MDAnalysis. Selection of reaction coordinates is done on an aptamer-by-aptamer basis, though at least partial automation of this procedure is possible.

3. Discussion

Following the method outlined in Section 2, we demonstrate the E2EDNA protocol on a medium-length aptamer in the presence of uridine triphosphate (UTP) in phosphate-buffered saline (PBS). The sequence of the aptamer we have chosen for this test study is:

TATGCATGTGGGCGACGCAGTGCCCGTGGGATTTACTTGCAC

In this section, we will generate a representative 3D structure and evaluate its binding to UTP via bases 39-40 in the -4-charge state, see Fig. 5.

Figure 5:

Figure 5:

(a) Example initial configuration for docking of UTP to representative aptamer structure, with the UTP adjacent to base 39, with a zoom-in on a rotated view in (b). The UTP is initialized edge-on to base 39, which is well ensconced in the helix.

3.1. Identification and Evaluation of Aptamer Fold

The first step in E2EDNA is identifying the candidate secondary structure, comprising a list of paired bases in the equilibrium structure, to be folded and evaluated in 3D. In Figure 2 we show the NUPACK predicted secondary structure and accompanying pair-by-pair bonding probabilities, as given by the color. We also show in this figure the user-defined reaction coordinates we follow during simulation trajectories to determine the stability of the overall structure.

Figure 2:

Figure 2:

(a) and (b) show the proposed aptamer secondary structure with local (a) and global (b) rearrangement reaction coordinates overlaid. The colors of the bases identify their equilibrium pairing probability according to NUPACK, with redder as more probable and bluer as less probable.

The ‘local’ reaction coordinates, RC’s 1-3, were selected to monitor the stability of the open loop (RC1) from base 25-35, as well as adjacent nominally paired areas (RC2 & RC3). Following these reaction coordinates allows us to confirm whether the predicted secondary structure is stable, i.e., whether key bases remain paired / unpaired over time. The ‘global’ coordinates, RC’s 4-6, were selected to assist in identification of the correct overall 3D structure. By tracking the distances between the three key secondary structural features (the open loop and the two largely paired ‘arms’), we can characterize 3D structural motifs, beyond the pairing and unpairing of particular groups of bases.

To generate initial configurations for MD trajectories, we feed MMB the set of paired bases predicted by NUPACK and through directed sampling and a basic annealing protocol it automatically folds a 3D structure which satisfies the applied base pairing conditions. While MMB automatically includes certain physical features such as helical stacking interactions between consecutive base pairs, the resulting structure is the product of annealing under strong, unphysical forces, and generally does not perfectly correspond to the relaxed structure found in solution at e.g., arbitrary ionic strength or pH. To illustrate this difference, see in Figure 3 typical examples of the aptamer structure immediately after MMB folding and after several ns of sampling under physiological conditions.

Figure 3:

Figure 3:

(a) shows a typical MMB output for the folded aptamer in an un-relaxed configuration. In (b) we see a representative 3D structure after several ns of MD sampling.

Evaluation of the secondary structure prediction and identification of representative 3D structure begins with the MMB output structure. In this case, we ran five parallel MMB folds and MD evaluations with a time-step of 2.0 fs and a total of 20 ns of sampling per-run. We exclude the first 2 nanoseconds of each trajectory as equilibration and present in Figure 4 the normalized free energy surfaces for each of the reaction coordinates identified in Figure 2. The temperature was 310K, pH 7.4 and ionic strength 163 mM. Relevant MMB and Tinker control files are provided in the SI.

Figure 4:

Figure 4:

Aptamer 3D conformation reaction coordinates and free energy in units of kT at 310K for two states: the free aptamer and aptamer with UTP molecule placed in the vicinity of base 39. The surfaces were generated using Equation 1, with the probability density computed by concatenation of the several equilibrated MD trajectories and the free energy minimum set independently to zero for each curve for easy visual comparison. Free energy profiles have been smoothed by a Gaussian kernel to aid readability.

Figure 4, subplots (ac) allow us to evaluate the correctness of the predicted secondary structure. Following RC 1, we can see that there is no ring-closing; the bases of the loop do not pair to form a hairpin. We observe from the dynamical trajectories that this loop collapses to a more compact conformation compared to the raw MMB output but remains flexible and unpaired. From RC2 and additional visual scrutiny, we can see that the hairpin from bases 10-25 is very stable throughout every free aptamer trajectory. The most interesting difference appears in RC3, where we see that there are at least two minima, one with the bases 9 and 35 paired, and one very wide basin where they have detached. Indeed, from tracking individual trajectories, we see this section of the aptamer, including bases 8 and 36, is rather labile, with frequent attaching/detaching. Thus, we can basically validate the predicted NUPACK secondary structure, noting that the prediction of a weaker base 9-35 contact was also notably correct.

3.2. Complexation and Analysis of Aptamer-Analyte Binding

Before proceeding with simulation and evaluation of binding of the analyte molecule (UTP in the -4-charge state), we must isolate a representative 3D structure with which to complex it. We accomplish this by analysis of the local (RC 1-3) and global (RC 4-6) reaction coordinates. After identifying the rough minima of each reaction coordinate, we can filter all our trajectories for structures which satisfy most or all of them, and so doing retrieve samples representative of the equilibrated 3D structure. See Figure 3 (b) for one such structure, upon which we will proceed to evaluate the binding of UTP to a particular part of the aptamer.

We chose base 39 as a potential binding site and we run five additional 20 ns trajectories starting from the representative structure, with the UTP initialized near base 39, and watch for any binding or reorganization. See Figure 5(a) for an example initial structure.

Figure 6 From these simulations we are able to glean the following information: 1) We extract the atomistic details of the binding between UTP and the aptamer. In this case, we observe that the binding does not involve π-stacking or hydrogen bonding and overall is rather weak. This is perhaps unsurprising since, as we see in Figure 5(b), base 39 is solidly bound in a helix and has little surface area available for base-base interactions. 2) We track the overall configurational response of the aptamer to the binding event. Figure 4 shows the free energy profiles for UTP-bound and free aptamer along several select reaction coordinates, RC1-6, chosen to report on the 3D configuration. The shifts in minima in these Free Energies indicate shifts in the overall configuration of the aptamer in the presence/absence of a ligand. 3) We track the distance between the UTP and the binding site as shown in Figure 6 in order to collect information about the stability of the complex. Furthermore, additional questions may be easily posed to the atomistic simulations and the relevant observables computed from the trajectory data.

Figure 6:

Figure 6:

Several DNA-UTP trajectories where we show the distance between the UTP analyte and base 39 as a function of time.

4. Figure 4 Summary and Outlook

We have presented and demonstrated E2EDNA, an end-to-end computational pipeline for the high-accuracy characterization and evaluation of DNA aptamer 3D structure, and aptamer-analyte binding under experimental conditions. Following this protocol, a secondary structure for a given aptamer is proposed, folded in 3D, and evaluated after extended sampling with explicit-solvent, all-atom molecular dynamics simulations. Then, once a representative aptamer structure is identified, one may complex the aptamer with the analyte of interest and evaluate their binding characteristics using further molecular dynamics simulations.

Our implementation of this protocol requires only the FASTA sequence of the aptamer to be analyzed, and the structure of the analyte molecule to get started. If necessary, automated parameterization of the analyte is straightforward using POLTYPE2. We then employ NUPACK and seqfold for secondary structure prediction, MacroMoleculeBuilder for directed folding of the aptamer, Tinker for molecular dynamics using the AMOEBA force-field, and MDAnalysis for analysis of the resulting trajectories. In our implementation, secondary structure prediction, folding and molecular dynamics sampling are all automated, though structural analysis (e.g., selection of important reaction coordinates) and analyte placement still must be done manually. We plan to automate these steps as well in a future development. For efficient deployment of the code, we recommend using Tinker9 on a GPU platform, where we can achieve ~5-10 ns/day of sampling on the aptamer complex from Section 3 on NVIDIA V100 GPUs.

Bringing together several disparate computational tools, E2EDNA presents a straightforward approach to aptamer structural and functional evaluation, with all predictions ultimately tested using high-accuracy all-atom explicit solvent molecular dynamics simulation. This protocol provides a necessary building block for future, in-silico studies on aptasensor design and evaluation. We hope it will be useful both in the context of exploring and verifying the binding mechanism for experimental aptasensors, as well as in guiding computational efforts for design of entirely new aptasensor platforms.

Supplementary Material

SI 01
Si 02

ACKNOWLEDGMENT

Funding from the NSERC Discovery grant RGPIN-2019-24734 and an NSERC PDF for M.K. is greatly appreciated. B.W. and P.R. are grateful for support from the National Institutes of Health (No. R01GM106137). Computations were made on the supercomputer Beluga, managed by Calcul Quebec (https://www.calculquebec.ca/) and Compute Canada (https://www.computecanada.ca/). The operation of this supercomputer is funded by the Canada Foundation for Innovation (CFI).

Footnotes

The authors declare no competing financial interests.

REFERENCES

  • 1.Mehlhorn A, Rahimi P, Joseph Y. Aptamer-based biosensors for antibiotic detection: A review. Biosensors. 2018;8. doi: 10.3390/bios8020054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sinha K, Das Mukhopadhyay C. Quantitative detection of neurotransmitter using aptamer: From diagnosis to therapeutics. J Biosci. 2020;45. doi: 10.1007/s12038-020-0017-x [DOI] [PubMed] [Google Scholar]
  • 3.Hou H, Jin Y, Wei H, Ji W, Xue Y, Hu J, et al. A Generalizable and Noncovalent Strategy for Interfacing Aptamers with a Microelectrode for the Selective Sensing of Neurotransmitters In Vivo. Angew Chemie. 2020;132: 19158–19162. doi: 10.1002/ange.202008284 [DOI] [PubMed] [Google Scholar]
  • 4.Zhou W, Saran R, Liu J. Metal Sensing by DNA. Chem Rev. 2017;117: 8272–8325. doi: 10.1021/acs.chemrev.7b00063 [DOI] [PubMed] [Google Scholar]
  • 5.Kirby R, Cho EJ, Gehrke B, Bayer T, Park YS, Neikirk DP, et al. Aptamer-based sensor arrays for the detection and quantitation of proteins. Anal Chem. 2004;76: 4066–4075. doi: 10.1021/ac049858n [DOI] [PubMed] [Google Scholar]
  • 6.Zhang Z, Oni O, Liu J. New insights into a classic aptamer: Binding sites, cooperativity and more sensitive adenosine detection. Nucleic Acids Res. 2017;45: 7593–7601. doi: 10.1093/nar/gkx517 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Huizenga DE, Szostak JW. A DNA Aptamer That Binds Adenosine and ATP. Biochemistry. 1995;34: 656–665. doi: 10.1021/bi00002a033 [DOI] [PubMed] [Google Scholar]
  • 8.Amaya-González S, de-los-Santos-Álvarez N, Miranda-Ordieres AJ, Lobo-Castañón MJ. Aptamer-based analysis: A promising alternative for food safety control. Sensors (Switzerland). 2013;13: 16292–16311. doi: 10.3390/s131216292 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Li F, Yu Z, Han X, Lai RY. Electrochemical aptamer-based sensors for food and water analysis: A review. Anal Chim Acta. 2019;1051: 1–23. doi: 10.1016/j.aca.2018.10.058 [DOI] [PubMed] [Google Scholar]
  • 10.Cho EJ, Lee JW, Ellington AD. Applications of aptamers as sensors. Annu Rev Anal Chem. 2009;2: 241–264. doi: 10.1146/annurev.anchem.1.031207.112851 [DOI] [PubMed] [Google Scholar]
  • 11.Tuszynska I, Matelska D, Magnus M, Chojnowski G, Kasprzak JM, Kozlowski LP, et al. Computational modeling of protein-RNA complex structures. Methods. 2014;65: 310–319. doi: 10.1016/j.ymeth.2013.09.014 [DOI] [PubMed] [Google Scholar]
  • 12.Caroli J, Forcato M, Bicciato S. APTANI2: Update of aptamer selection through sequence-structure analysis. Bioinformatics. 2020;36: 2266–2268. doi: 10.1093/bioinformatics/btz897 [DOI] [PubMed] [Google Scholar]
  • 13.Fernanzes-Arias AM. Aptafolding : Gan That Folds Aptamers. Universidad Politecnica de Madrid. 2020. [Google Scholar]
  • 14.Lorenz R, Bernhart SH, Höner zu Siederdissen C, Tafer H, Flamm C, Stadler PF, et al. ViennaRNA Package 2.0. Algorithms Mol Biol. 2011;6. doi: 10.1186/1748-7188-6-26 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cheng CY, Chou FC, Das R. Modeling complex RNA tertiary folds with Rosetta. 1st ed. Methods in Enzymology. Elsevier Inc.; 2015. doi: 10.1016/bs.mie.2014.10.051 [DOI] [PubMed] [Google Scholar]
  • 16.Wu JC, Chattree G, Ren P. Automation of AMOEBA polarizable force field parameterization for small molecules. Theor Chem Acc. 2012;131: 1–11. doi: 10.1007/s00214-012-1138-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Walker B, Jing Z, Ren P. Molecular dynamics free energy simulations of ATP: Mg2+ and ADP:Mg2+ using the polarisable force field AMOEBA. Mol Simul. 2020;0: 1–10. doi: 10.1080/08927022.2020.1725003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Vanommeslaeghe K, MacKerell AD. Automation of the CHARMM general force field (CGenFF) I: Bond perception and atom typing. J Chem Inf Model. 2012;52: 3144–3154. doi: 10.1021/ci300363c [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Vanommeslaeghe K, MacKerell AD. Automation of the CHARMM general force field (CGenFF) II: Assignment of Bonded Parameters and Partial Atomic Charges. J Chem Inf Model. 2012;52: 3144–3154. doi: 10.1021/ci300363c [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Dunn MR, Jimenez RM, Chaput JC. Analysis of aptamer discovery and technology. Nat Rev Chem. 2017;1. doi: 10.1038/s41570-017-0076 [DOI] [Google Scholar]
  • 21.Capriotti E, Norambuena T, Marti-Renom MA, Melo F. All-atom knowledge-based potential for RNA structure prediction and assessment. Bioinformatics. 2011;27: 1086–1093. doi: 10.1093/bioinformatics/btr093 [DOI] [PubMed] [Google Scholar]
  • 22.Zadeh JN, Steenberg CD, Bois JS, Wolfe BR, Pierce MB, Khan AR, et al. NUPACK: Analysis and design of nucleic acid systems. J Comput Chem. 2011;32: 170–173. doi: 10.1002/jcc.21596 [DOI] [PubMed] [Google Scholar]
  • 23.Flores SC, Sherman MA, Bruns CM, Eastman P, Altman RB. Fast flexible modeling of RNA structure using internal coordinates. IEEE/ACM Trans Comput Biol Bioinforma. 2011;8: 1247–1257. doi: 10.1109/TCBB.2010.104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Van Zundert GCP, Rodrigues JPGLM, Trellet M, Schmitz C, Kastritis PL, Karaca E, et al. The HADDOCK2.2 Web Server: User-Friendly Integrative Modeling of Biomolecular Complexes. J Mol Biol. 2016;428: 720–725. doi: 10.1016/j.jmb.2015.09.014 [DOI] [PubMed] [Google Scholar]
  • 25.Navien TN, Thevendran R, Hamdani HY, Tang TH, Citartan M. In silico molecular docking in DNA aptamer development. Biochimie. 2021;180: 54–67. doi: 10.1016/j.biochi.2020.10.005 [DOI] [PubMed] [Google Scholar]
  • 26.Pagadala NS, Syed K, Tuszynski J. Software for molecular docking: a review. Biophys Rev. 2017;9: 91–102. doi: 10.1007/s12551-016-0247-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Taylor RD, Jewsbury PJ, Essex JW. A review of protein-small molecule docking methods - Taylor-JCAMD2002.pdf. J Comput Aided Mol Des. 2002;16: 151–166. Available: https://link.springer.com/content/pdf/10.1023%2FA%3A1020155510718.pdf%0Ahttp://infochimie.u-strasbg.fr/master/tutochemo/TP10/Docking_PDF_2010/Bibliography/Taylor-JCAMD2002.pdf [DOI] [PubMed] [Google Scholar]
  • 28.Ritchie DW, Venkatraman V. Ultra-fast FFT protein docking on graphics processors. Bioinformatics. 2010;26: 2398–2405. doi: 10.1093/bioinformatics/btq444 [DOI] [PubMed] [Google Scholar]
  • 29.Chuang GY, Kozakov D, Brenke R, Comeau SR, Vajda S. DARS (Decoys As the Reference State) potentials for protein-protein docking. Biophys J. 2008;95: 4217–4227. doi: 10.1529/biophysj.108.135814 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ma X, Kong X, Zhang S, Hovy E. MaCow: Masked Convolutional Generative Flow. 2019; 1–10. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SI 01
Si 02

RESOURCES