setOption(Redis::OPT_SERIALIZER, Redis::SERIALIZER_IGBINARY); * $redis->setOption(Redis::OPT_PACK_IGNORE_NUMBERS, true); * $redis->set('answer', 32); * * var_dump($redis->incrBy('answer', 10)); // int(42) * var_dump($redis->get('answer')); // int(42) */ public const OPT_PACK_IGNORE_NUMBERS = UNKNOWN; /** * Sets the serializer to none (no serialization). * * @var int * @cvalue REDIS_SERIALIZER_NONE * */ public const SERIALIZER_NONE = UNKNOWN; /** * Sets the serializer to PHP's built-in `serialize()`/`unserialize()` * * @var int * @cvalue REDIS_SERIALIZER_PHP * */ public const SERIALIZER_PHP = UNKNOWN; #ifdef HAVE_REDIS_IGBINARY /** * Sets the serializer to igbinary. Note that phpredis must be compiled * with ighbinary support to use this serializer. * * @var int * @cvalue REDIS_SERIALIZER_IGBINARY * */ public const SERIALIZER_IGBINARY = UNKNOWN; #endif #ifdef HAVE_REDIS_MSGPACK /** * Sets the serializer to msgpack. Note that phpredis must be compiled * with msgpack support to use this serializer. * * @var int * @cvalue REDIS_SERIALIZER_MSGPACK * */ public const SERIALIZER_MSGPACK = UNKNOWN; #endif /** * Sets the serializer to JSON. * * @var int * @cvalue REDIS_SERIALIZER_JSON * */ public const SERIALIZER_JSON = UNKNOWN; /** * Disables compression. * * @var int * @cvalue REDIS_COMPRESSION_NONE * */ public const COMPRESSION_NONE = UNKNOWN; #ifdef HAVE_REDIS_LZF /** * Sets the compression algorithm to LZF. PhpRedis must be compiled with * lzf support but this serializer is bundled with the extension. * * @var int * @cvalue REDIS_COMPRESSION_LZF * */ public const COMPRESSION_LZF = UNKNOWN; #endif #ifdef HAVE_REDIS_ZSTD /** * Sets the compression algorithm to ZSTD. PhpRedis must be compiled with * zstd support to use this serializer. This is often the best balance * between speed and compression ratio. * * @var int * @cvalue REDIS_COMPRESSION_ZSTD * */ public const COMPRESSION_ZSTD = UNKNOWN; #ifdef ZSTD_CLEVEL_DEFAULT /** * This constant represents the "default" compression level for ZSTD. If * PhpRedis is compiled against a new enough ZSTD the value comes from the * library, otherwise we just set it to 3. * * @var int * @cvalue ZSTD_CLEVEL_DEFAULT * */ public const COMPRESSION_ZSTD_DEFAULT = UNKNOWN; #else /** * This constant represents the "default" compression level for ZSTD. If * PhpRedis is compiled against a new enough ZSTD the value comes from the * library, otherwise we just set it to 3. * * @var int * */ public const COMPRESSION_ZSTD_DEFAULT = 3; #endif #if ZSTD_VERSION_NUMBER >= 10400 /** * The minimum compression level ZSTD supports, which comes from the * underlying ZSTD library if new enough. Otherwise we just set it to 1. * * @var int * @cvalue ZSTD_minCLevel() * */ public const COMPRESSION_ZSTD_MIN = UNKNOWN; #else /** * The minimum compression level ZSTD supports, which comes from the * underlying ZSTD library if new enough. Otherwise we just set it to 1. * * @var int * */ public const COMPRESSION_ZSTD_MIN = 1; #endif /** * The maximum compression level ZSTD supports, which comes from the * underlying ZSTD library. * * @var int * @cvalue ZSTD_maxCLevel() */ public const COMPRESSION_ZSTD_MAX = UNKNOWN; #endif #ifdef HAVE_REDIS_LZ4 /** * Set the compression algorithm to LZ4. PhpRedis must be compiled with * lz4 support to use this serializer. This algorithm is generally * the fastest but has a lower compression ratio than ZSTD. * * @var int * @cvalue REDIS_COMPRESSION_LZ4 * */ public const COMPRESSION_LZ4 = UNKNOWN; #endif /** * Used with `\Redis::setOption()` to specify scan options. * * @var int * @cvalue REDIS_OPT_SCAN * */ public const OPT_SCAN = UNKNOWN; /** * When enabled, this option causes PhpRedis to automatically retry `SCAN` * commands when Redis returns a non-zero cursor but no keys. This can * happen due to the nature of Redis' scanning algorithm. * * @var int * @cvalue REDIS_SCAN_RETRY * */ public const SCAN_RETRY = UNKNOWN; /** * Then enabled, this option tells PhpRedis to not retry `SCAN` commands * when Redis returns a non-zero cursor but no keys. This means that your * code must handle this case itself. * * @var int * @cvalue REDIS_SCAN_NORETRY * */ public const SCAN_NORETRY = UNKNOWN; /** * Tells PhpRedis to prefix keys returned from `SCAN` commands with the * currently set key prefix. * * @var int * @cvalue REDIS_SCAN_PREFIX * */ public const SCAN_PREFIX = UNKNOWN; /** * Tells PhpRedis to NOT prefix keys returned from `SCAN` commands with * the currently set key prefix. * * @var int * @cvalue REDIS_SCAN_NOPREFIX * */ public const SCAN_NOPREFIX = UNKNOWN; /** * This is just the string "before" which is used with various list * commands to indicate an insertion point. * * @var string * */ public const BEFORE = "before"; /** * This is just the string "after" which is used with various list commands * to indicate an insertion point. * * @var string * */ public const AFTER = "after"; /** * This is just the string "left" which is used with various list commands * such as `LMOVE`. * * @var string * */ public const LEFT = "left"; /** * This is just the string "right" which is used with various list commands * such as `LMOVE`. * * @var string * */ public const RIGHT = "right"; /** * How many times should `PhpRedis` attempt to reconnect when we are * disconnected. * * @var int * @cvalue REDIS_OPT_MAX_RETRIES * */ public const OPT_MAX_RETRIES = UNKNOWN; /** * Used to specify the backoff algorithm to use when reconnecting. * * @var int * @cvalue REDIS_OPT_BACKOFF_ALGORITHM * */ public const OPT_BACKOFF_ALGORITHM = UNKNOWN; /** * Default backoff - random delay before the first retry, then constant `base` ms. * * @var int * @cvalue REDIS_BACKOFF_ALGORITHM_DEFAULT * */ public const BACKOFF_ALGORITHM_DEFAULT = UNKNOWN; /** * Constant backoff - always sleep for exactly `base` ms (capped by `cap`). * * @var int * @cvalue REDIS_BACKOFF_ALGORITHM_CONSTANT * */ public const BACKOFF_ALGORITHM_CONSTANT = UNKNOWN; /** * Uniform backoff - randomly sleep between 0 and `base` ms for each retry. * * @var int * @cvalue REDIS_BACKOFF_ALGORITHM_UNIFORM * */ public const BACKOFF_ALGORITHM_UNIFORM = UNKNOWN; /** * Exponential backoff - doubles the delay every retry (up to 2^10) before `cap`. * * @var int * @cvalue REDIS_BACKOFF_ALGORITHM_EXPONENTIAL * */ public const BACKOFF_ALGORITHM_EXPONENTIAL = UNKNOWN; /** * Full jitter - exponential delay but pick a random value between 0 and that delay. * * @var int * @cvalue REDIS_BACKOFF_ALGORITHM_FULL_JITTER * */ public const BACKOFF_ALGORITHM_FULL_JITTER = UNKNOWN; /** * Equal jitter - half the exponential delay plus a random amount up to the other half. * * @var int * @cvalue REDIS_BACKOFF_ALGORITHM_EQUAL_JITTER * */ public const BACKOFF_ALGORITHM_EQUAL_JITTER = UNKNOWN; /** * Decorrelated jitter - pick a random delay between `base` and 3x the previous delay. * * @var int * @cvalue REDIS_BACKOFF_ALGORITHM_DECORRELATED_JITTER * */ public const BACKOFF_ALGORITHM_DECORRELATED_JITTER = UNKNOWN; /** * Backoff base - minimum delay in milliseconds that algorithms start from. * * @var int * @cvalue REDIS_OPT_BACKOFF_BASE * */ public const OPT_BACKOFF_BASE = UNKNOWN; /** * Backoff cap - maximum delay in milliseconds that any algorithm can reach. * * @var int * @cvalue REDIS_OPT_BACKOFF_CAP * */ public const OPT_BACKOFF_CAP = UNKNOWN; /** * Create a new Redis instance. If passed sufficient information in the * options array it is also possible to connect to an instance at the same * time. * * **NOTE**: Below is an example options array with various setting * *```php *$options = [ * 'host' => 'localhost', * 'port' => 6379, * 'readTimeout' => 2.5, * 'connectTimeout' => 2.5, * 'persistent' => true, * * // Valid formats: NULL, ['user', 'pass'], 'pass', or ['pass'] * 'auth' => ['phpredis', 'phpredis'], * * // See PHP stream options for valid SSL configuration settings. * 'ssl' => ['verify_peer' => false], * * // How quickly to retry a connection after we time out or it closes. * // Note that this setting is overridden by 'backoff' strategies. * 'retryInterval' => 100, * * // Which backoff algorithm to use. 'decorrelated jitter' is * // likely the best one for most solution, but there are many * // to choose from: * // REDIS_BACKOFF_ALGORITHM_DEFAULT * // REDIS_BACKOFF_ALGORITHM_CONSTANT * // REDIS_BACKOFF_ALGORITHM_UNIFORM * // REDIS_BACKOFF_ALGORITHM_EXPONENTIAL * // REDIS_BACKOFF_ALGORITHM_FULL_JITTER * // REDIS_BACKOFF_ALGORITHM_EQUAL_JITTER * // REDIS_BACKOFF_ALGORITHM_DECORRELATED_JITTER * // 'base', and 'cap' are in milliseconds and represent the first * // delay redis will use when reconnecting, and the maximum delay * // we will reach while retrying. * 'backoff' => [ * 'algorithm' => Redis::BACKOFF_ALGORITHM_DECORRELATED_JITTER, * 'base' => 500, * 'cap' => 750, * ] *]; *``` * * Note: If you do wish to connect via the constructor, only 'host' is * strictly required, which will cause PhpRedis to connect to that * host on Redis' default port (6379). * * * @see Redis::connect() * @see https://aws.amazon.com/blogs/architecture/exponential-backoff-and-jitter/ * @param array|null $options * * @return Redis * * @example * $redis = new Redis(['host' => '127.0.0.1', 'port' => 6380]); * */ public function __construct(?array $options = null); /** * Destructor to clean up the Redis object. * * This method will disconnect from Redis. If the connection is persistento * it will be stashed for future reuse. * */ public function __destruct(); /** * Compress a value with the currently configured compressor (Redis::OPT_COMPRESSION) * exactly the same way PhpRedis does before sending data to Redis. * * @see Redis::setOption() * * @param string $value The value to be compressed * @return string The compressed result (or the original value if compression is disabled) * * @example * $redis->_compress('payload'); * */ public function _compress(string $value): string; /** * Uncompress the provided argument using the compressor configured via * Redis::setOption() (Redis::OPT_COMPRESSION). * * @see Redis::setOption() * * @param string $value The compressed value to uncompress. * @return string The uncompressed result. * * @example * $redis->_uncompress($redis->_compress('payload')); * */ public function _uncompress(string $value): string; /** * Prefix the passed argument with the currently set key prefix as set * with Redis::setOption(). * * @param string $key The key/string to prefix * @return string The prefixed string * * @example * $redis->_prefix('user:42'); * */ public function _prefix(string $key): string; /** * Serialize the provided value with the currently set serializer as set * with Redis::setOption(). * * @see Redis::setOption() * * @param mixed $value The value to serialize * @return string The serialized result * * @example * $redis->_serialize(['answer' => 42]); * */ public function _serialize(mixed $value): string; /** * Unserialize the passed argument with the currently set serializer as set * with Redis::setOption(). * * @see Redis::setOption() * * @param string $value The value to unserialize * @return mixed The unserialized result * * @example * $redis->_unserialize($redis->_serialize(['answer' => 42])); * */ public function _unserialize(string $value): mixed; /** * Pack the provided value by first serializing it (if Redis::OPT_SERIALIZER is set) * and then compressing the serialized payload (if Redis::OPT_COMPRESSION is set), * mirroring exactly what PhpRedis transmits to Redis. * * @param mixed $value The value to pack * @return string The packed result having been serialized and * compressed. * * @example * $redis->_pack(['count' => 5]); * */ public function _pack(mixed $value): string; /** * Compute the XXH3 digest of a PHP value after it has been `_pack`ed, producing * the same digest Redis' DIGEST command would return for the stored value. * * @param mixed $value The value to compute the digest for. * @return string The computed digest. * * @throws RedisException If XXH3 is not supported. * * @note This function requires PHP >= 8.1 which is the version PHP * added support for XXH3 hashing and made the hash extension * mandatory. * * @example * $redis->_digest(['token' => 'abc']); * */ public function _digest(mixed $value): string; /** * Unpack the provided value by first uncompressing it (if Redis::OPT_COMPRESSION * is set) and then unserializing it (if Redis::OPT_SERIALIZER is set) to recover * the original PHP value. * * @param string $value The value which has been serialized and compressed. * @return mixed The uncompressed and deserialized value. * * @example * $redis->_unpack($redis->_pack(['count' => 5])); * */ public function _unpack(string $value): mixed; /** * Execute Redis ACL subcommands. * * @see https://redis.io/docs/latest/commands/acl/ * * @example * $redis->acl('list'); */ public function acl(string $subcmd, string ...$args): mixed; /** * Append data to a Redis STRING key. * * @param string $key The key in question * @param mixed $value The data to append to the key. * * @return Redis|int|false The new string length of the key or false on failure. * * @see https://redis.io/docs/latest/commands/append/ * * @example * $redis->set('foo', 'hello); * $redis->append('foo', 'world'); */ public function append(string $key, mixed $value): Redis|int|false; /** * Authenticate a Redis connection after its been established. * * $redis->auth('password'); * $redis->auth(['password']); * $redis->auth(['username', 'password']); * * @see https://redis.io/docs/latest/commands/auth/ * * @param mixed $credentials A string password, or an array with one or two string elements. * @return Redis|bool Whether the AUTH was successful. * * @example * $redis->auth('secret'); * */ public function auth(#[\SensitiveParameter] mixed $credentials): Redis|bool; /** * Execute a save of the Redis database in the background. * * @see https://redis.io/docs/latest/commands/bgsave/ * * @return Redis|bool Whether the command was successful. * * @example * $redis->bgSave(); * */ public function bgSave(): Redis|bool; /** * Asynchronously rewrite Redis' append-only file * * @see https://redis.io/docs/latest/commands/bgrewriteaof/ * * @return Redis|bool Whether the command was successful. * * @example * $redis->bgrewriteaof(); * */ public function bgrewriteaof(): Redis|bool; /** * @see https://redis.io/docs/latest/commands/waitaof/ * * @return Redis|array|false * * @example * $redis->waitaof(1, 1, 5000); * */ public function waitaof(int $numlocal, int $numreplicas, int $timeout): Redis|array|false; /** * Count the number of set bits in a Redis string. * * @see https://redis.io/docs/latest/commands/bitcount/ * * @param string $key The key in question (must be a string key) * @param int $start The index where Redis should start counting. If omitted it * defaults to zero, which means the start of the string. * @param int $end The index where Redis should stop counting. If omitted it * defaults to -1, meaning the very end of the string. * * @param bool $bybit Whether or not Redis should treat $start and $end as bit * positions, rather than bytes. * * @return Redis|int|false The number of bits set in the requested range. * * @example * $redis->bitcount('bitmap', 0, -1); * */ public function bitcount(string $key, int $start = 0, int $end = -1, bool $bybit = false): Redis|int|false; public function bitop(string $operation, string $deskey, string $srckey, string ...$other_keys): Redis|int|false; /** * Return the position of the first bit set to 0 or 1 in a string. * * @see https://redis.io/docs/latest/commands/bitpos/ * * @param string $key The key to check (must be a string) * @param bool $bit Whether to look for an unset (0) or set (1) bit. * @param int $start Where in the string to start looking. * @param int $end Where in the string to stop looking. * @param bool $bybit If true, Redis will treat $start and $end as BIT values and not bytes, so if start * was 0 and end was 2, Redis would only search the first two bits. * * @return Redis|int|false The position of the first set or unset bit. * * @example * $redis->bitpos('bitmap', true, 0, -1); * **/ public function bitpos(string $key, bool $bit, int $start = 0, int $end = -1, bool $bybit = false): Redis|int|false; /** * Pop an element off the beginning of a Redis list or lists, potentially blocking up to a specified * timeout. This method may be called in two distinct ways, of which examples are provided below. * * @see https://redis.io/docs/latest/commands/blpop/ * * @param string|array $key_or_keys This can either be a string key or an array of one or more * keys. * @param string|float|int $timeout_or_key If the previous argument was a string key, this can either * be an additional key, or the timeout you wish to send to * the command. * * @return Redis|array|null|false Can return various things depending on command and data in Redis. * * @example * $redis->blPop('list1', 'list2', 'list3', 1.5); * $relay->blPop(['list1', 'list2', 'list3'], 1.5); */ public function blPop(string|array $key_or_keys, string|float|int $timeout_or_key, mixed ...$extra_args): Redis|array|null|false; /** * Pop an element off of the end of a Redis list or lists, potentially blocking up to a specified timeout. * The calling convention is identical to Redis::blPop() so see that documentation for more details. * * @see https://redis.io/docs/latest/commands/brpop/ * @see Redis::blPop() * * @example * $redis->brPop(['queue:critical', 'queue:default'], 5); * */ public function brPop(string|array $key_or_keys, string|float|int $timeout_or_key, mixed ...$extra_args): Redis|array|null|false; /** * Pop an element from the end of a Redis list, pushing it to the beginning of another Redis list, * optionally blocking up to a specified timeout. * * @see https://redis.io/docs/latest/commands/brpoplpush/ * * @param string $src The source list * @param string $dst The destination list * @param int|float $timeout The number of seconds to wait. Note that you must be connected * to Redis >= 6.0.0 to send a floating point timeout. * * @example * $redis->brpoplpush('queue:pending', 'queue:processing', 5); * */ public function brpoplpush(string $src, string $dst, int|float $timeout): Redis|string|false; /** * POP the maximum scoring element off of one or more sorted sets, blocking up to a specified * timeout if no elements are available. * * Following are examples of the two main ways to call this method. * * **NOTE**: We recommend calling this function with an array and a timeout as the other strategy * may be deprecated in future versions of PhpRedis * * @see https://redis.io/docs/latest/commands/bzpopmax/ * * @param string|array $key Either a string key or an array of one or more keys. * @param string|int $timeout_or_key If the previous argument was an array, this argument * must be a timeout value. Otherwise it could also be * another key. * @param mixed ...$extra_args Can consist of additional keys, until the last argument * which needs to be a timeout. * * @return Redis|array|false The popped elements. * * @example * $redis->bzPopMax('key1', 'key2', 'key3', 1.5); * $redis->bzPopMax(['key1', 'key2', 'key3'], 1.5); */ public function bzPopMax(string|array $key, string|int $timeout_or_key, mixed ...$extra_args): Redis|array|false; /** * POP the minimum scoring element off of one or more sorted sets, blocking up to a specified timeout * if no elements are available * * This command is identical in semantics to bzPopMax so please see that method for more information. * * @see https://redis.io/docs/latest/commands/bzpopmin/ * @see Redis::bzPopMax() * * @example * $redis->bzPopMin(['scores:high', 'scores:low'], 1.5); * */ public function bzPopMin(string|array $key, string|int $timeout_or_key, mixed ...$extra_args): Redis|array|false; /** * POP one or more elements from one or more sorted sets, blocking up to a specified amount of time * when no elements are available. * * @param float $timeout How long to block if there are no element available * @param array $keys The sorted sets to pop from * @param string $from The string 'MIN' or 'MAX' (case insensitive) telling Redis whether you wish to * pop the lowest or highest scoring members from the set(s). * @param int $count Pop up to how many elements. * * @return Redis|array|null|false This function will return an array of popped elements, or false * depending on whether any elements could be popped within the * specified timeout. * * NOTE: If Redis::OPT_NULL_MULTIBULK_AS_NULL is set to true via Redis::setOption(), this method will * instead return NULL when Redis doesn't pop any elements. * * @see https://redis.io/docs/latest/commands/bzmpop/ * * @example * $redis->bzmpop(1.5, ['scores:high', 'scores:low'], 'MIN', 2); * */ public function bzmpop(float $timeout, array $keys, string $from, int $count = 1): Redis|array|null|false; /** * POP one or more of the highest or lowest scoring elements from one or more sorted sets. * * @see https://redis.io/docs/latest/commands/zmpop/ * * @param array $keys One or more sorted sets * @param string $from The string 'MIN' or 'MAX' (case insensitive) telling Redis whether you want to * pop the lowest or highest scoring elements. * @param int $count Pop up to how many elements at once. * * @return Redis|array|null|false An array of popped elements or false if none could be popped. * * @example * $redis->zmpop(['scores:high', 'scores:low'], 'MAX', 2); * */ public function zmpop(array $keys, string $from, int $count = 1): Redis|array|null|false; /** * Pop one or more elements from one or more Redis LISTs, blocking up to a specified timeout when * no elements are available. * * @see https://redis.io/docs/latest/commands/blmpop/ * * @param float $timeout The number of seconds Redis will block when no elements are available. * @param array $keys One or more Redis LISTs to pop from. * @param string $from The string 'LEFT' or 'RIGHT' (case insensitive), telling Redis whether * to pop elements from the beginning or end of the LISTs. * @param int $count Pop up to how many elements at once. * * @return Redis|array|null|false One or more elements popped from the list(s) or false if all LISTs * were empty. * * @example * $redis->blmpop(1.5, ['queue:critical', 'queue:default'], 'LEFT', 2); * */ public function blmpop(float $timeout, array $keys, string $from, int $count = 1): Redis|array|null|false; /** * Pop one or more elements off of one or more Redis LISTs. * * @see https://redis.io/docs/latest/commands/lmpop/ * * @param array $keys An array with one or more Redis LIST key names. * @param string $from The string 'LEFT' or 'RIGHT' (case insensitive), telling Redis whether to pop\ * elements from the beginning or end of the LISTs. * @param int $count The maximum number of elements to pop at once. * * @return Redis|array|null|false One or more elements popped from the LIST(s) or false if all the LISTs * were empty. * * @example * $redis->lmpop(['queue:critical', 'queue:default'], 'RIGHT', 2); * */ public function lmpop(array $keys, string $from, int $count = 1): Redis|array|null|false; /** * Reset any last error on the connection to NULL * * @see Redis::getLastError() * @return bool This should always return true or throw an exception if we're not connected. * * @example * $redis = new Redis(['host' => 'localhost']); * $redis->set('string', 'this_is_a_string'); * $redis->smembers('string'); * var_dump($redis->getLastError()); * $redis->clearLastError(); * var_dump($redis->getLastError()); */ public function clearLastError(): bool; /** * Execute Redis CLIENT subcommands. * * @param string $opt The CLIENT subcommand to execute. * @param mixed ...$args Additional arguments depending on the subcommand. * * @see https://redis.io/docs/latest/commands/client/ * * @example * $redis->client('list'); */ public function client(string $opt, mixed ...$args): mixed; /** * Closes the connection to Redis * * This function will close the connection whether it is persistent or not. * * @return bool Whether the connection was successfully closed. * * @example * $redis = new Redis; * $redis->pconnect('localhost', 6379); * $id1 = $redis->client('id'); * $redis->close(); * * $redis = new Redis; * $redis->pconnect('localhost', 6379); * $id2 = $redis->client('id'); * * // Will print "id is different" * printf("ID is %s\n", $id1 == $id2 ? 'the same' : 'different'); */ public function close(): bool; /** * Execute Redis COMMAND subcommands. * * @see https://redis.io/docs/latest/commands/command/ * * @example * $redis->command('command'); */ public function command(?string $opt = null, mixed ...$args): mixed; /** * Execute the Redis CONFIG command in a variety of ways. * * What the command does in particular depends on the `$operation` qualifier. * Operations that PhpRedis supports are: RESETSTAT, REWRITE, GET, and SET. * * @param string $operation The CONFIG operation to execute (e.g. GET, SET, REWRITE). * @param array|string|null $key_or_settings One or more keys or values. * @param string|null $value The value if this is a `CONFIG SET` operation. * @see https://redis.io/docs/latest/commands/config/ * * @example * $redis->config('GET', 'timeout'); * $redis->config('GET', ['timeout', 'databases']); * $redis->config('SET', 'timeout', 30); * $redis->config('SET', ['timeout' => 30, 'loglevel' => 'warning']); */ public function config(string $operation, array|string|null $key_or_settings = null, ?string $value = null): mixed; /** * Connect to a Redis server * * @param string $host The Redis server hostname or IP * address. * @param int $port The Redis server port. Defaults to * 6379. * @param float $timeout The connection timeout in seconds. * Defaults to 0 (no timeout). * @param string|null $persistent_id If set, a persistent connection will * be made with this ID. * @param int $retry_interval The number of milliseconds to wait * between connection attempts. * @param float $read_timeout The read timeout in seconds. * Defaults to 0 (no timeout). * @param array|null $context An optional stream context to use * when connecting. * See `\Redis::__construct()` for more * details. * @return bool Whether the connection was successful. * * @throws RedisException On connection errors. * * @example * $redis = new \Redis; * try { * $redis->connect('localhost', 6379, 2.5, null, 100, 2.5); * $foo = $redis->get('foo'); * printf("foo: %s\n", $foo); * } catch (Exception $ex) { * fprintf(STDERR, "Error: {$ex->getMessage()}\n"); * } */ public function connect(string $host, int $port = 6379, float $timeout = 0, ?string $persistent_id = null, int $retry_interval = 0, float $read_timeout = 0, ?array $context = null): bool; /** * Make a copy of a key. * * $redis = new Redis(['host' => 'localhost']); * * @param string $src The key to copy * @param string $dst The name of the new key created from the source key. * @param array|null $options An array with modifiers on how COPY should operate. * ```php * $options = [ * 'REPLACE' => true|false # Whether to replace an existing key. * 'DB' => int # Copy key to specific db. * ]; * ``` * * @return Redis|bool True if the copy was completed and false if not. * * @see https://redis.io/docs/latest/commands/copy/ * * @example * $redis->pipeline() * ->select(1) * ->del('newkey') * ->select(0) * ->del('newkey') * ->mset(['source1' => 'value1', 'exists' => 'old_value']) * ->exec(); * * var_dump($redis->copy('source1', 'newkey')); * var_dump($redis->copy('source1', 'newkey', ['db' => 1])); * var_dump($redis->copy('source1', 'exists')); * var_dump($redis->copy('source1', 'exists', ['REPLACE' => true])); */ public function copy(string $src, string $dst, ?array $options = null): Redis|bool; /** * Return the number of keys in the currently selected Redis database. * * @see https://redis.io/docs/latest/commands/dbsize/ * * @return Redis|int|false The number of keys or false on failure. * * @example * $redis = new Redis(['host' => 'localhost']); * $redis->flushdb(); * $redis->set('foo', 'bar'); * var_dump($redis->dbsize()); * $redis->mset(['a' => 'a', 'b' => 'b', 'c' => 'c', 'd' => 'd']); * var_dump($redis->dbsize()); */ public function dbSize(): Redis|int|false; /** * Execute the Redis `DEBUG` command. Note that this is disabled by default * and can be very dangerous, even allowing you to crash the server. Use * with caution * * @note The command has greatly increased in complexity since it was first * added to PhpRedis, so you may need to use it via `Redis::rawCommand()` * for certain subcommands. * * @param string $key The DEBUG subcommand to execute. * @return Redis|string The result of the DEBUG command. */ public function debug(string $key): Redis|string; /** * Decrement a Redis integer by 1 or a provided value. * * @param string $key The key to decrement * @param int $by How much to decrement the key. Note that if this value is * not sent or is set to `1`, PhpRedis will actually invoke * the 'DECR' command. If it is any value other than `1` * PhpRedis will actually send the `DECRBY` command. * * @return Redis|int|false The new value of the key or false on failure. * * @see https://redis.io/docs/latest/commands/decr/ * @see https://redis.io/docs/latest/commands/decrby/ * * @example $redis->decr('counter'); * @example $redis->decr('counter', 2); */ public function decr(string $key, int $by = 1): Redis|int|false; /** * Decrement a redis integer by a value * * @param string $key The integer key to decrement. * @param int $value How much to decrement the key. * * @return Redis|int|false The new value of the key or false on failure. * * @see https://redis.io/docs/latest/commands/decrby/ * * @example $redis->decrby('counter', 1); * @example $redis->decrby('counter', 2); */ public function decrBy(string $key, int $value): Redis|int|false; /** * Delete one or more keys from Redis. * * This method can be called in two distinct ways. The first is to pass a single array * of keys to delete, and the second is to pass N arguments, all names of keys. See * below for an example of both strategies. * * @param array|string $key Either an array with one or more key names or a string with * the name of a key. * @param string ...$other_keys One or more additional keys passed in a variadic fashion. * * @return Redis|int|false The number of keys that were deleted * * @see https://redis.io/docs/latest/commands/del/ * * @example $redis->del('key:0', 'key:1'); * @example $redis->del(['key:2', 'key:3', 'key:4']); */ public function del(array|string $key, string ...$other_keys): Redis|int|false; /** * Delete a key conditionally based on its value or hash digest * * @param string $key The key to delete * @param array|null $options An array with options to modify how DELX works. * * @return Redis|int|false Returns 1 if the key was deleted, 0 if it was not. * * @see https://redis.io/docs/latest/commands/delex/ * * @example * $redis->delex('session:42'); * */ public function delex(string $key, ?array $options = null): Redis|int|false; /** * Delete a key if it's equal to the specified value. This command is * specific to Valkey >= 9.0 * * @param string $key The key to delete * @param mixed $value The value to compare against the key's value. * @return Redis|int|false Returns 1 if the key was deleted, 0 if it was not. * * @see https://valkey.io/commands/delifeq/ * * @example * $redis->delifeq('session:42', 'token'); * */ public function delifeq(string $key, mixed $value): Redis|int|false; /** * @deprecated * @alias Redis::del * * @see https://redis.io/docs/latest/commands/del/ * * @example * $redis->delete('legacy:key'); * */ public function delete(array|string $key, string ...$other_keys): Redis|int|false; /** * Discard a transaction currently in progress. * * @return Redis|bool True if we could discard the transaction. * * @see https://redis.io/docs/latest/commands/discard/ * * @example * $redis->getMode(); * $redis->set('foo', 'bar'); * $redis->discard(); * $redis->getMode(); */ public function discard(): Redis|bool; /** * Dump Redis' internal binary representation of a key. * * @param string $key The key to dump. * * @return Redis|string|false A binary string representing the key's value. * * @see https://redis.io/docs/latest/commands/dump/ * * @example * $redis->zadd('zset', 0, 'zero', 1, 'one', 2, 'two'); * $binary = $redis->dump('zset'); * $redis->restore('new-zset', 0, $binary); */ public function dump(string $key): Redis|string|false; /** * Have Redis repeat back an arbitrary string to the client. * * @param string $str The string to echo * * @return Redis|string|false The string sent to Redis or false on failure. * * @see https://redis.io/docs/latest/commands/echo/ * * @example $redis->echo('Hello, World'); */ public function echo(string $str): Redis|string|false; /** * Execute a LUA script on the redis server. * * @see https://redis.io/docs/latest/commands/eval/ * * @param string $script A string containing the LUA script * @param array $args An array of arguments to pass to this script * @param int $num_keys How many of the arguments are keys. This is needed * as redis distinguishes between key name arguments * and other data. * * @return mixed LUA scripts may return arbitrary data so this method can return * strings, arrays, nested arrays, etc. * * @example * $redis->eval('return redis.call("set", KEYS[1], ARGV[1])', ['counter', 1], 1); * */ public function eval(string $script, array $args = [], int $num_keys = 0): mixed; /** * This is simply the read-only variant of eval, meaning the underlying script * may not modify data in redis. * * @see Redis::eval_ro() * @see https://redis.io/docs/latest/commands/eval_ro/ * * @example * $redis->eval_ro('return redis.call("get", KEYS[1])', ['counter'], 1); * */ public function eval_ro(string $script_sha, array $args = [], int $num_keys = 0): mixed; /** * Execute a LUA script on the server but instead of sending the script, send * the SHA1 hash of the script. * * @param string $sha1 The SHA1 hash of the lua code. Note that the script * must already exist on the server, either having been * loaded with `SCRIPT LOAD` or having been executed directly * with `EVAL` first. * @param array $args Arguments to send to the script. * @param int $num_keys The number of arguments that are keys * * @return mixed Returns whatever the specific script does. * * @see https://redis.io/docs/latest/commands/evalsha/ * @see Redis::eval(); * * @example * $sha = $redis->script('load', 'return redis.call("incr", KEYS[1])'); * $redis->evalsha($sha, ['counter'], 1); * */ public function evalsha(string $sha1, array $args = [], int $num_keys = 0): mixed; /** * This is simply the read-only variant of evalsha, meaning the underlying script * may not modify data in redis. * * @see Redis::evalsha() * @see https://redis.io/docs/latest/commands/evalsha_ro/ * * @example * $sha = $redis->script('load', 'return redis.call("get", KEYS[1])'); * $redis->evalsha_ro($sha, ['counter'], 1); * */ public function evalsha_ro(string $sha1, array $args = [], int $num_keys = 0): mixed; /** * Execute either a MULTI or PIPELINE block and return the array of replies. * * @return Redis|array|false The array of pipeline'd or multi replies or false on failure. * * @see https://redis.io/docs/latest/commands/exec/ * @see https://redis.io/docs/latest/commands/multi/ * @see Redis::pipeline() * @see Redis::multi() * * @example * $res = $redis->multi() * ->set('foo', 'bar') * ->get('foo') * ->del('list') * ->rpush('list', 'one', 'two', 'three') * ->exec(); */ public function exec(): Redis|array|false; /** * Test if one or more keys exist. * * @param mixed $key Either an array of keys or a string key * @param mixed ...$other_keys If the previous argument was a string, you may send any number of * additional keys to test. * * @return Redis|int|bool The number of keys that do exist and false on failure * * @see https://redis.io/docs/latest/commands/exists/ * * @example $redis->exists(['k1', 'k2', 'k3']); * @example $redis->exists('k4', 'k5', 'notakey'); */ public function exists(mixed $key, mixed ...$other_keys): Redis|int|bool; /** * Sets an expiration in seconds on the key in question. If connected to * redis-server >= 7.0.0 you may send an additional "mode" argument which * modifies how the command will execute. * * @param string $key The key to set an expiration on. * @param int $timeout The number of seconds after which key will be automatically deleted. * @param string|null $mode A two character modifier that changes how the * command works. * * NX - Set expiry only if key has no expiry * XX - Set expiry only if key has an expiry * LT - Set expiry only when new expiry is < current expiry * GT - Set expiry only when new expiry is > current expiry * * * @return Redis|bool True if an expiration was set and false otherwise. * @see https://redis.io/docs/latest/commands/expire/ * * @example * $redis->expire('session:42', 60); * */ public function expire(string $key, int $timeout, ?string $mode = null): Redis|bool; /* * Set a key's expiration to a specific Unix timestamp in seconds. * * If connected to Redis >= 7.0.0 you can pass an optional 'mode' argument. * @see Redis::expire() For a description of the mode argument. * * @param string $key The key to set an expiration on. * * @return Redis|bool True if an expiration was set, false if not. * */ /** * Set a key to expire at an exact unix timestamp. * * @param string $key The key to set an expiration on. * @param int $timestamp The unix timestamp to expire at. * @param string|null $mode An option 'mode' that modifies how the command acts (see {@link Redis::expire}). * @return Redis|bool True if an expiration was set, false if not. * * @see https://redis.io/docs/latest/commands/expireat/ * @see https://redis.io/docs/latest/commands/expire/ * @see Redis::expire() * * @example * $redis->expireAt('session:42', time() + 300); * */ public function expireAt(string $key, int $timestamp, ?string $mode = null): Redis|bool; public function failover(?array $to = null, bool $abort = false, int $timeout = 0): Redis|bool; /** * Get the expiration of a given key as a unix timestamp * * @param string $key The key to check. * * @return Redis|int|false The timestamp when the key expires, or -1 if the key has no expiry * and -2 if the key doesn't exist. * * @see https://redis.io/docs/latest/commands/expiretime/ * * @example * $redis->setEx('mykey', 60, 'myval'); * $redis->expiretime('mykey'); */ public function expiretime(string $key): Redis|int|false; /** * Get the expiration timestamp of a given Redis key but in milliseconds. * * @see https://redis.io/docs/latest/commands/pexpiretime/ * @see Redis::expiretime() * * @param string $key The key to check * * @return Redis|int|false The expiration timestamp of this key (in milliseconds) or -1 if the * key has no expiration, and -2 if it does not exist. * * @example * $redis->pexpiretime('session:42'); * */ public function pexpiretime(string $key): Redis|int|false; /** * Invoke a function. * * @param string $fn The name of the function * @param array $keys Optional list of keys * @param array $args Optional list of args * * @return mixed Function may return arbitrary data so this method can return * strings, arrays, nested arrays, etc. * * @see https://redis.io/docs/latest/commands/fcall/ * * @example * $redis->fcall('mylib.increment', ['counter'], [1]); * */ public function fcall(string $fn, array $keys = [], array $args = []): mixed; /** * This is a read-only variant of the FCALL command that cannot execute commands that modify data. * * @param string $fn The name of the function * @param array $keys Optional list of keys * @param array $args Optional list of args * * @return mixed Function may return arbitrary data so this method can return * strings, arrays, nested arrays, etc. * * @see https://redis.io/docs/latest/commands/fcall_ro/ * * @example * $redis->fcall_ro('mylib.peek', ['counter']); * */ public function fcall_ro(string $fn, array $keys = [], array $args = []): mixed; /** * Deletes every key in all Redis databases * * @param bool $sync Whether to perform the task in a blocking or non-blocking way. * * @see https://redis.io/docs/latest/commands/flushall/ * * @example * $redis->flushAll(true); * */ public function flushAll(?bool $sync = null): Redis|bool; /** * Deletes all the keys of the currently selected database. * * @param bool $sync Whether to perform the task in a blocking or non-blocking way. * * @see https://redis.io/docs/latest/commands/flushdb/ * * @example * $redis->flushDB(true); * */ public function flushDB(?bool $sync = null): Redis|bool; /** * Functions is an API for managing code to be executed on the server. * * @param string $operation The subcommand you intend to execute. Valid options are as follows * 'LOAD' - Create a new library with the given library name and code. * 'DELETE' - Delete the given library. * 'LIST' - Return general information on all the libraries * 'STATS' - Return information about the current function running * 'KILL' - Kill the current running function * 'FLUSH' - Delete all the libraries * 'DUMP' - Return a serialized payload representing the current libraries * 'RESTORE' - Restore the libraries represented by the given payload * @param mixed ...$args Additional arguments * * @return Redis|bool|string|array Depends on subcommand. * * @see https://redis.io/docs/latest/commands/function/ * * @example * $redis->function('LIST'); * */ public function function(string $operation, mixed ...$args): Redis|bool|string|array; /** * Add one or more members to a geospacial sorted set * * @param string $key The sorted set to add data to. * @param float $lng The longitude of the first member * @param float $lat The latitude of the first member. * @param mixed ...$other_triples_and_options You can continue to pass longitude, latitude, and member * arguments to add as many members as you wish. Optionally, the final argument may be * a string with options for the command @see Redis documentation for the options. * * @return Redis|int|false The number of added elements is returned. If the 'CH' option is specified, * the return value is the number of members *changed*. * * @example $redis->geoAdd('cities', -121.8374, 39.7284, 'Chico', -122.03218, 37.322, 'Cupertino'); * @example $redis->geoadd('cities', -121.837478, 39.728494, 'Chico', ['XX', 'CH']); * * @see https://redis.io/docs/latest/commands/geoadd/ */ public function geoadd(string $key, float $lng, float $lat, string $member, mixed ...$other_triples_and_options): Redis|int|false; /** * Get the distance between two members of a geospacially encoded sorted set. * * @param string $key The Sorted set to query. * @param string $src The first member. * @param string $dst The second member. * @param string|null $unit Which unit to use when computing distance, defaulting to meters. * * M - meters * KM - kilometers * FT - feet * MI - miles * * * @return Redis|float|false The calculated distance in whichever units were specified or false * if one or both members did not exist. * * @example $redis->geodist('cities', 'Chico', 'Cupertino', 'mi'); * * @see https://redis.io/docs/latest/commands/geodist/ */ public function geodist(string $key, string $src, string $dst, ?string $unit = null): Redis|float|false; /** * Retrieve one or more GeoHash encoded strings for members of the set. * * @param string $key The key to query * @param string $member The first member to request * @param string ...$other_members One or more additional members to request. * * @return Redis|array|false An array of GeoHash encoded values. * * @see https://redis.io/docs/latest/commands/geohash/ * @see https://en.wikipedia.org/wiki/Geohash * * @example $redis->geohash('cities', 'Chico', 'Cupertino'); */ public function geohash(string $key, string $member, string ...$other_members): Redis|array|false; /** * Return the longitude and latitude for one or more members of a geospacially encoded sorted set. * * @param string $key The set to query. * @param string $member The first member to query. * @param string ...$other_members One or more members to query. * * @return Redis|array|false An array of longitude and latitude pairs. * * @see https://redis.io/docs/latest/commands/geopos/ * * @example $redis->geopos('cities', 'Seattle', 'New York'); */ public function geopos(string $key, string $member, string ...$other_members): Redis|array|false; /** * Retrieve members of a geospacially sorted set that are within a certain radius of a location. * * @param string $key The set to query * @param float $lng The longitude of the location to query. * @param float $lat The latitude of the location to query. * @param float $radius The radius of the area to include. * @param string $unit The unit of the provided radius (defaults to 'meters). * See {@link Redis::geodist} for possible units. * @param array $options An array of options that modifies how the command behaves. * ```php * $options = [ * 'WITHCOORD', # Return members and their coordinates. * 'WITHDIST', # Return members and their distances from the center. * 'WITHHASH', # Return members GeoHash string. * 'ASC' | 'DESC', # The sort order of returned members * * # Limit to N returned members. Optionally a two element array may be * # passed as the `LIMIT` argument, and the `ANY` argument. * 'COUNT' => [], or [, ] * * # Instead of returning members, store them in the specified key. * 'STORE' => * * # Store the distances in the specified key * 'STOREDIST' => * ]; * ``` * * @return mixed This command can return various things, depending on the options passed. * * @see https://redis.io/docs/latest/commands/georadius/ * * @example $redis->georadius('cities', 47.608013, -122.335167, 1000, 'km'); */ public function georadius(string $key, float $lng, float $lat, float $radius, string $unit, array $options = []): mixed; /** * A readonly variant of `GEORADIUS` that may be executed on replicas. * * @see Redis::georadius * @see https://redis.io/docs/latest/commands/georadius_ro/ * * @example * $redis->georadius_ro('cities', -122.335167, 47.608013, 100, 'km'); * */ public function georadius_ro(string $key, float $lng, float $lat, float $radius, string $unit, array $options = []): mixed; /** * Similar to `GEORADIUS` except it uses a member as the center of the query. * * @param string $key The key to query. * @param string $member The member to treat as the center of the query. * @param float $radius The radius from the member to include. * @param string $unit The unit of the provided radius * See {@link Redis::geodist} for possible units. * @param array $options An array with various options to modify the command's behavior. * See {@link Redis::georadius} for options. * * @return mixed This command can return various things depending on options. * * @see https://redis.io/docs/latest/commands/georadiusbymember/ * * @example $redis->georadiusbymember('cities', 'Seattle', 200, 'mi'); */ public function georadiusbymember(string $key, string $member, float $radius, string $unit, array $options = []): mixed; /** * This is the read-only variant of `GEORADIUSBYMEMBER` that can be run on replicas. * * @see https://redis.io/docs/latest/commands/georadiusbymember_ro/ * * @example * $redis->georadiusbymember_ro('cities', 'Seattle', 200, 'mi'); * */ public function georadiusbymember_ro(string $key, string $member, float $radius, string $unit, array $options = []): mixed; /** * Search a geospacial sorted set for members in various ways. * * @param string $key The set to query. * @param array|string $position Either a two element array with longitude and latitude, or * a string representing a member of the set. * @param array|int|float $shape Either a number representine the radius of a circle to search, or * a two element array representing the width and height of a box * to search. * @param string $unit The unit of our shape. See {@link Redis::geodist} for possible units. * @param array $options @see {@link Redis::georadius} for options. Note that the `STORE` * options are not allowed for this command. * * @see https://redis.io/docs/latest/commands/geosearch/ * * @example * $redis->geosearch('cities', 'Seattle', 50, 'km', ['WITHDIST']); * */ public function geosearch(string $key, array|string $position, array|int|float $shape, string $unit, array $options = []): array; /** * Search a geospacial sorted set for members within a given area or range, storing the results into * a new set. * * @param string $dst The destination where results will be stored. * @param string $src The key to query. * @param array|string $position Either a two element array with longitude and latitude, or * a string representing a member of the set. * @param array|int|float $shape Either a number representine the radius of a circle to search, or * a two element array representing the width and height of a box * to search. * @param string $unit The unit of our shape. See {@link Redis::geodist} for possible units. * @param array $options * ```php * $options = [ * 'ASC' | 'DESC', # The sort order of returned members * 'WITHDIST' # Also store distances. * * # Limit to N returned members. Optionally a two element array may be * # passed as the `LIMIT` argument, and the `ANY` argument. * 'COUNT' => [], or [, ] * ]; * ``` * * @see https://redis.io/docs/latest/commands/geosearchstore/ * * @example * $redis->geosearchstore('west:cities', 'cities', 'Seattle', 50, 'km', ['DESC']); * */ public function geosearchstore(string $dst, string $src, array|string $position, array|int|float $shape, string $unit, array $options = []): Redis|array|int|false; /** * Retrieve a string keys value. * * @param string $key The key to query * @return mixed The keys value or false if it did not exist. * * @see https://redis.io/docs/latest/commands/get/ * * @example $redis->get('foo'); */ public function get(string $key): mixed; /** * Retrieve a value and metadata of key. * * @param string $key The key to query * @return Redis|array|false * * @example $redis->getWithMeta('foo'); */ public function getWithMeta(string $key): Redis|array|false; /** * Get the authentication information on the connection, if any. * * @return mixed The authentication information used to authenticate the connection. * * @see Redis::auth() * * @example * $redis->getAuth(); * */ public function getAuth(): mixed; /** * Get the bit at a given index in a string key. * * @param string $key The key to query. * @param int $idx The Nth bit that we want to query. * * @example $redis->getbit('bitmap', 1337); * * @see https://redis.io/docs/latest/commands/getbit/ */ public function getBit(string $key, int $idx): Redis|int|false; /** * Get the value of a key and optionally set it's expiration. * * @param string $key The key to query * @param array $options Options to modify how the command works. * ```php * $options = [ * 'EX' => # Expire in N seconds * 'PX' => # Expire in N milliseconds * 'EXAT' => # Expire at a unix timestamp (in seconds) * 'PXAT' => # Expire at a unix timestamp (in milliseconds); * 'PERSIST' # Remove any configured expiration on the key. * ]; * ``` * * @return Redis|string|bool The key's value or false if it didn't exist. * * @see https://redis.io/docs/latest/commands/getex/ * * @example $redis->getEx('mykey', ['EX' => 60]); */ public function getEx(string $key, array $options = []): Redis|string|bool; /** * Get the database number PhpRedis thinks we're connected to. * * This value is updated internally in PhpRedis each time {@link Redis::select} is called. * * @return int The database we're connected to. * * @see Redis::select() * @see https://redis.io/docs/latest/commands/select/ * * @example * $redis->getDBNum(); * */ public function getDBNum(): int; /** * Get a key from Redis and delete it in an atomic operation. * * @param string $key The key to get/delete. * @return Redis|string|bool The value of the key or false if it didn't exist. * * @see https://redis.io/docs/latest/commands/getdel/ * * @example $redis->getdel('token:123'); */ public function getDel(string $key): Redis|string|bool; /** * Return the host or Unix socket we are connected to. * * @return string The host or Unix socket. * * @example * $redis->getHost(); * */ public function getHost(): string; /** * Get the last error returned to us from Redis, if any. * * @return string|null The error string or NULL if there is none. * * @example * $redis->getLastError(); * */ public function getLastError(): string|null; /** * Returns whether the connection is in ATOMIC, MULTI, or PIPELINE mode * * @return int The mode we're in. * * @example * $redis->getMode(); * */ public function getMode(): int; /** * Retrieve the value of a configuration setting as set by Redis::setOption() * * @see Redis::setOption() for a detailed list of options and their values. * * @return mixed The setting itself or false on failure * * @example * $redis->getOption(Redis::OPT_PREFIX); * */ public function getOption(int $option): mixed; /** * Get the persistent connection ID, if there is one. * * @return string|null The ID or NULL if we don't have one. * * @example * $redis->getPersistentID(); * */ public function getPersistentID(): string|null; /** * Get the port we are connected to. This number will be zero if we are connected to a unix socket. * * @return int The port. * * @example * $redis->getPort(); * */ public function getPort(): int; /** * Get the server name as reported by the `HELLO` response. * * @return string|false * * @example * $redis->serverName(); * */ public function serverName(): string|false; /** * Get the server version as reported by the `HELLO` response. * * @return string|false * * @example * $redis->serverVersion(); * */ public function serverVersion(): string|false; /** * Retrieve a substring of a string by index. * * @param string $key The string to query. * @param int $start The zero-based starting index. * @param int $end The zero-based ending index. * * @return Redis|string|false The substring or false on failure. * * @see https://redis.io/docs/latest/commands/getrange/ * * @example * $redis->set('silly-word', 'Supercalifragilisticexpialidocious'); * echo $redis->getRange('silly-word', 0, 4) . "\n"; */ public function getRange(string $key, int $start, int $end): Redis|string|false; /** * Get the longest common subsequence between two string keys. * * @param string $key1 The first key to check * @param string $key2 The second key to check * @param array|null $options An optional array of modifiers for the command. * * ```php * $options = [ * 'MINMATCHLEN' => int # Exclude matching substrings that are less than this value * * 'WITHMATCHLEN' => bool # Whether each match should also include its length. * * 'LEN' # Return the length of the longest subsequence * * 'IDX' # Each returned match will include the indexes where the * # match occurs in each string. * ]; * ``` * * NOTE: 'LEN' cannot be used with 'IDX'. * * @return Redis|string|array|int|false Various reply types depending on options. * * @see https://redis.io/docs/latest/commands/lcs/ * * @example * $redis->set('seq1', 'gtaggcccgcacggtctttaatgtatccctgtttaccatgccatacctgagcgcatacgc'); * $redis->set('seq2', 'aactcggcgcgagtaccaggccaaggtcgttccagagcaaagactcgtgccccgctgagc'); * echo $redis->lcs('seq1', 'seq2') . "\n"; */ public function lcs(string $key1, string $key2, ?array $options = null): Redis|string|array|int|false; /** * Get the currently set read timeout on the connection. * * @return float The timeout. * * @example * $redis->getReadTimeout(); * */ public function getReadTimeout(): float; /** * Sets a key and returns any previously set value, if the key already existed. * * @param string $key The key to set. * @param mixed $value The value to set the key to. * * @return Redis|string|false The old value of the key or false if it didn't exist. * * @see https://redis.io/docs/latest/commands/getset/ * * @example * $redis->getset('captain', 'Pike'); * $redis->getset('captain', 'Kirk'); */ public function getset(string $key, mixed $value): Redis|string|false; /** * Retrieve any set connection timeout * * @return float|false The currently set timeout or false on failure (e.g. we aren't connected). * * @example * $redis->getTimeout(); * */ public function getTimeout(): float|false; /** * Get the number of bytes sent and received on the socket. * * @return array An array in the form [$sent_bytes, $received_bytes] * * @example * $redis->getTransferredBytes(); * */ public function getTransferredBytes(): array; /** * Reset the number of bytes sent and received on the socket. * * @return void * * @example * $redis->clearTransferredBytes(); * */ public function clearTransferredBytes(): void; /** * Remove one or more fields from a hash. * * @param string $key The hash key in question. * @param string $field The first field to remove * @param string ...$other_fields One or more additional fields to remove. * * @return Redis|int|false The number of fields actually removed. * * @see https://redis.io/docs/latest/commands/hdel/ * * @example $redis->hDel('communication', 'Alice', 'Bob'); */ public function hDel(string $key, string $field, string ...$other_fields): Redis|int|false; /** * Checks whether a field exists in a hash. * * @param string $key The hash to query. * @param string $field The field to check * * @return Redis|bool True if it exists, false if not. * * @see https://redis.io/docs/latest/commands/hexists/ * * @example $redis->hExists('communication', 'Alice'); */ public function hExists(string $key, string $field): Redis|bool; public function hGet(string $key, string $member): mixed; /** * Read every field and value from a hash. * * @param string $key The hash to query. * @return Redis|array|false All fields and values or false if the key didn't exist. * * @see https://redis.io/docs/latest/commands/hgetall/ * * @example * $redis->hgetall('myhash'); */ public function hGetAll(string $key): Redis|array|false; /** * Retrieve a value and metadata of hash field. * * @param string $key The key to query * @param string $member The key to query * @return mixed * * @example $redis->hgetWithMeta('foo', 'field'); */ public function hGetWithMeta(string $key, string $member): mixed; /** * Increment a hash field's value by an integer * * @param string $key The hash to modify * @param string $field The field to increment * @param int $value How much to increment the value. * * @return Redis|int|false The new value of the field. * * @see https://redis.io/docs/latest/commands/hincrby/ * * @example * $redis->hMSet('player:1', ['name' => 'Alice', 'score' => 0]); * $redis->hincrby('player:1', 'score', 10); * */ public function hIncrBy(string $key, string $field, int $value): Redis|int|false; /** * Increment a hash field by a floating point value * * @param string $key The hash with the field to increment. * @param string $field The field to increment. * * @return Redis|float|false The field value after incremented. * * @see https://redis.io/docs/latest/commands/hincrbyfloat/ * * @example * $redis->hincrbyfloat('numbers', 'tau', 2 * 3.1415926); */ public function hIncrByFloat(string $key, string $field, float $value): Redis|float|false; /** * Retrieve all of the fields of a hash. * * @param string $key The hash to query. * * @return Redis|list|false The fields in the hash or false if the hash doesn't exist. * * @see https://redis.io/docs/latest/commands/hkeys/ * * @example $redis->hkeys('myhash'); */ public function hKeys(string $key): Redis|array|false; /** * Get the number of fields in a hash. * * @see https://redis.io/docs/latest/commands/hlen/ * * @param string $key The hash to check. * * @return Redis|int|false The number of fields or false if the key didn't exist. * * @example $redis->hlen('myhash'); */ public function hLen(string $key): Redis|int|false; /** * Get one or more fields from a hash. * * @param string $key The hash to query. * @param array $fields One or more fields to query in the hash. * * @return Redis|array|false The fields and values or false if the key didn't exist. * * @see https://redis.io/docs/latest/commands/hmget/ * * @example $redis->hMGet('player:1', ['name', 'score']); */ public function hMget(string $key, array $fields): Redis|array|false; /** * Get one or more fields of a hash while optionally setting expiration * information * * @param string $key The hash to query. * @param array $fields One or more fields to query in the hash. * @param string|array|null $expiry Info about the expiration * * @return Redis|array|false The fields and values or false if the key didn't exist. * * @see https://redis.io/docs/latest/commands/hgetex/ * * @example * $redis->hgetex('profiles', ['name', 'email'], ['EX' => 60]); * */ public function hgetex(string $key, array $fields, string|array|null $expiry = null): Redis|array|false; /** * Set one or more fields in a hash with optional expiration information. * * @param string $key The hash to create/update. * @param array $fields An array with fields values. * @param array|null $expiry Info about the expiration * * @return Redis|int|false One if fields were set zero if not. * * @see https://redis.io/docs/latest/commands/hsetex/ * * @example * $redis->hsetex('profiles', ['token' => 'abc123'], ['EX' => 60]); * */ public function hsetex(string $key, array $fields, ?array $expiry = null): Redis|int|false; /** * Get one or more fields and delete them * * @param string $key The hash in question * @param array $fields One or more fields * * @return Redis|array|false The field and values or false on failure * * @see https://redis.io/docs/latest/commands/hgetdel/ * * @example * $redis->hgetdel('profiles', ['token']); * */ public function hgetdel(string $key, array $fields): Redis|array|false; /** * Add or update one or more hash fields and values * * @param string $key The hash to create/update * @param array $fieldvals An associative array with fields and their values. * * @return Redis|bool True if the operation was successful * * @see https://redis.io/docs/latest/commands/hmset/ * * @example $redis->hmset('updates', ['status' => 'starting', 'elapsed' => 0]); */ public function hMset(string $key, array $fieldvals): Redis|bool; /** * Get one or more random field from a hash. * * @param string $key The hash to query. * @param array|null $options An array of options to modify how the command behaves. * * ```php * $options = [ * 'COUNT' => int # An optional number of fields to return. * 'WITHVALUES' => bool # Also return the field values. * ]; * ``` * * @return Redis|string|array|false One or more random fields (and possibly values). * * @see https://redis.io/docs/latest/commands/hrandfield/ * * @example $redis->hrandfield('settings'); * @example $redis->hrandfield('settings', ['count' => 2, 'withvalues' => true]); */ public function hRandField(string $key, ?array $options = null): Redis|string|array|false; /** * Add or update one or more hash fields and values. * * @param string $key The hash to create/update. * @param mixed ...$fields_and_vals Argument pairs of fields and values. Alternatively, an associative array with the * fields and their values. * * @return Redis|int|false The number of fields that were added, or false on failure. * * @see https://redis.io/docs/latest/commands/hset/ * * @example $redis->hSet('player:1', 'name', 'Kim', 'score', 78); * @example $redis->hSet('player:1', ['name' => 'Kim', 'score' => 78]); */ public function hSet(string $key, mixed ...$fields_and_vals): Redis|int|false; /** * Set a hash field and value, but only if that field does not exist * * @param string $key The hash to update. * @param string $field The value to set. * * @return Redis|bool True if the field was set and false if not. * * @see https://redis.io/docs/latest/commands/hsetnx/ * * @example * $redis->hsetnx('player:1', 'lock', 'enabled'); * $redis->hsetnx('player:1', 'lock', 'enabled'); */ public function hSetNx(string $key, string $field, mixed $value): Redis|bool; /** * Get the string length of a hash field * * @param string $key The hash to query. * @param string $field The field to query. * * @return Redis|int|false The string length of the field or false. * * @example * $redis = new Redis(['host' => 'localhost']); * $redis->del('hash'); * $redis->hmset('hash', ['50bytes' => str_repeat('a', 50)]); * $redis->hstrlen('hash', '50bytes'); * * @see https://redis.io/docs/latest/commands/hstrlen/ */ public function hStrLen(string $key, string $field): Redis|int|false; /** * Get all of the values from a hash. * * @param string $key The hash to query. * * @return Redis|list|false The values from the hash. * * @see https://redis.io/docs/latest/commands/hvals/ * * @example $redis->hvals('player:1'); */ public function hVals(string $key): Redis|array|false; /** * Set the expiration on one or more fields in a hash. * * @param string $key The hash to update. * @param int $ttl The time to live in seconds. * @param array $fields The fields to set the expiration on. * @param string|null $mode An optional mode (NX, XX, ETC) * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/hexpire/ * * @example * $redis->hexpire('profiles', 300, ['token'], 'NX'); * */ public function hexpire(string $key, int $ttl, array $fields, ?string $mode = NULL): Redis|array|false; /** * Set the expiration on one or more fields in a hash in milliseconds. * * @param string $key The hash to update. * @param int $ttl The time to live in milliseconds. * @param array $fields The fields to set the expiration on. * @param string|null $mode An optional mode (NX, XX, ETC) * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/hexpire/ * * @example * $redis->hpexpire('profiles', 1500, ['token']); * */ public function hpexpire(string $key, int $ttl, array $fields, ?string $mode = NULL): Redis|array|false; /** * Set the expiration time on one or more fields of a hash. * * @param string $key The hash to update. * @param int $time The time to live in seconds. * @param array $fields The fields to set the expiration on. * @param string|null $mode An optional mode (NX, XX, ETC) * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/hexpire/ * * @example * $redis->hexpireat('profiles', time() + 600, ['token']); * */ public function hexpireat(string $key, int $time, array $fields, ?string $mode = NULL): Redis|array|false; /** * Set the expiration time on one or more fields of a hash in milliseconds. * * @param string $key The hash to update. * @param int $mstime The time to live in milliseconds. * @param array $fields The fields to set the expiration on. * @param string|null $mode An optional mode (NX, XX, ETC) * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/hexpire/ * * @example * $redis->hpexpireat('profiles', (int) (microtime(true) * 1000) + 60000, ['token']); * */ public function hpexpireat(string $key, int $mstime, array $fields, ?string $mode = NULL): Redis|array|false; /** * Get the TTL of one or more fields in a hash * * @param string $key The hash to query. * @param array $fields The fields to query. * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/httl/ * * @example * $redis->httl('profiles', ['token']); * */ public function httl(string $key, array $fields): Redis|array|false; /** * Get the millisecond TTL of one or more fields in a hash * * @param string $key The hash to query. * @param array $fields The fields to query. * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/hpttl/ * * @example * $redis->hpttl('profiles', ['token']); * */ public function hpttl(string $key, array $fields): Redis|array|false; /** * Get the expiration time of one or more fields in a hash * * @param string $key The hash to query. * @param array $fields The fields to query. * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/hexpiretime/ * * @example * $redis->hexpiretime('profiles', ['token']); * */ public function hexpiretime(string $key, array $fields): Redis|array|false; /** * Get the expiration time in milliseconds of one or more fields in a hash * * @param string $key The hash to query. * @param array $fields The fields to query. * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/hpexpiretime/ * * @example * $redis->hpexpiretime('profiles', ['token']); * */ public function hpexpiretime(string $key, array $fields): Redis|array|false; /** * Persist one or more hash fields * * @param string $key The hash to query. * @param array $fields The fields to query. * * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/hpersist/ * * @example * $redis->hpersist('profiles', ['token']); * */ public function hpersist(string $key, array $fields): Redis|array|false; /** * Iterate over the fields and values of a hash in an incremental fashion. * * @see https://redis.io/docs/latest/commands/hscan/ * @see https://redis.io/docs/latest/commands/scan/ * * @param string $key The hash to query. * @param int|string|null $iterator The scan iterator, which should be initialized to NULL before the first call. * This value will be updated after every call to hscan, until it reaches zero * meaning the scan is complete. * @param string|null $pattern An optional glob-style pattern to filter fields with. * @param int $count An optional hint to Redis about how many fields and values to return per HSCAN. * * @return Redis|array|bool An array with a subset of fields and values. * * @example * $redis = new Redis(['host' => 'localhost']); * * $redis->del('big-hash'); * * for ($i = 0; $i < 1000; $i++) { * $fields["field:$i"] = "value:$i"; * } * * $redis->hmset('big-hash', $fields); * * $it = null; * * do { * // Scan the hash but limit it to fields that match '*:1?3' * $fields = $redis->hscan('big-hash', $it, '*:1?3'); * * foreach ($fields as $field => $value) { * echo "[$field] => $value\n"; * } * } while ($it != 0); */ public function hscan(string $key, null|int|string &$iterator, ?string $pattern = null, int $count = 0): Redis|array|bool; /** * Set an expiration on a key member (KeyDB only). * * @see https://docs.keydb.dev/docs/commands/#expiremember * @see https://redis.io/docs/latest/commands/expiremember/ * * @param string $key The key to expire * @param string $field The field to expire * @param string|null $unit The unit of the ttl (s, or ms). * * @example * $redis->expiremember('profiles', 'token', 60); * */ public function expiremember(string $key, string $field, int $ttl, ?string $unit = null): Redis|int|false; /** * Set an expiration on a key membert to a specific unix timestamp (KeyDB only). * * @see https://docs.keydb.dev/docs/commands/#expirememberat * @see https://redis.io/docs/latest/commands/expirememberat/ * * @param string $key The key to expire * @param string $field The field to expire * @param int $timestamp The unix timestamp to expire at. * * @example * $redis->expirememberat('profiles', 'token', time() + 300); * */ public function expirememberat(string $key, string $field, int $timestamp): Redis|int|false; /** * Increment a key's value, optionally by a specific amount. * * @see https://redis.io/docs/latest/commands/incr/ * @see https://redis.io/docs/latest/commands/incrby/ * * @param string $key The key to increment * @param int $by An optional amount to increment by. * * @return Redis|int|false The new value of the key after incremented. * * @example $redis->incr('mycounter'); * @example $redis->incr('mycounter', 10); */ public function incr(string $key, int $by = 1): Redis|int|false; /** * Increment a key by a specific integer value * * @see https://redis.io/docs/latest/commands/incrby/ * * @param string $key The key to increment. * @param int $value The amount to increment. * * @example * $redis->set('primes', 2); * $redis->incrby('primes', 1); * $redis->incrby('primes', 2); * $redis->incrby('primes', 2); * $redis->incrby('primes', 4); */ public function incrBy(string $key, int $value): Redis|int|false; /** * Increment a numeric key by a floating point value. * * @param string $key The key to increment * @param float $value How much to increment (or decrement) the value. * * @return Redis|float|false The new value of the key or false if the key didn't contain a string. * * @see https://redis.io/docs/latest/commands/incrbyfloat/ * * @example * $redis->incrbyfloat('tau', 3.1415926); * $redis->incrbyfloat('tau', 3.1415926); */ public function incrByFloat(string $key, float $value): Redis|float|false; /** * Retrieve information about the connected redis-server. If no arguments are passed to * this function, redis will return every info field. Alternatively you may pass a specific * section you want returned (e.g. 'server', or 'memory') to receive only information pertaining * to that section. * * If connected to Redis server >= 7.0.0 you may pass multiple optional sections. * * @see https://redis.io/docs/latest/commands/info/ * * @param string ...$sections Optional section(s) you wish Redis server to return. * * @return Redis|array|false * * @example * $redis->info('server', 'stats'); * */ public function info(string ...$sections): Redis|array|false; /** * Check if we are currently connected to a Redis instance. * * @return bool True if we are, false if not * * @example * $redis->isConnected(); * */ public function isConnected(): bool; /** * @param string $pattern * @return Redis|list|false * * @see https://redis.io/docs/latest/commands/keys/ * * @example * $redis->keys('session:*'); * */ public function keys(string $pattern); /** * @return Redis|int|false * * @see https://redis.io/docs/latest/commands/linsert/ * * @example * $redis->lInsert('letters', Redis::AFTER, 'b', 'beta'); * */ public function lInsert(string $key, string $pos, mixed $pivot, mixed $value); /** * Retrieve the length of a list. * * @param string $key The list * * @return Redis|int|false The number of elements in the list or false on failure. * * @see https://redis.io/docs/latest/commands/llen/ * * @example * $redis->lLen('queue'); * */ public function lLen(string $key): Redis|int|false; /** * Move an element from one list into another. * * @param string $src The source list. * @param string $dst The destination list * @param string $wherefrom Where in the source list to retrieve the element. This can be either * - `Redis::LEFT`, or `Redis::RIGHT`. * @param string $whereto Where in the destination list to put the element. This can be either * - `Redis::LEFT`, or `Redis::RIGHT`. * @return Redis|string|false The element removed from the source list. * * @see https://redis.io/docs/latest/commands/lmove/ * * @example * $redis->rPush('numbers', 'one', 'two', 'three'); * $redis->lMove('numbers', 'odds', Redis::LEFT, Redis::LEFT); */ public function lMove(string $src, string $dst, string $wherefrom, string $whereto): Redis|string|false; /** * Move an element from one list to another, blocking up to a timeout until an element is available. * * @param string $src The source list * @param string $dst The destination list * @param string $wherefrom Where in the source list to extract the element. * - `Redis::LEFT`, or `Redis::RIGHT`. * @param string $whereto Where in the destination list to put the element. * - `Redis::LEFT`, or `Redis::RIGHT`. * @param float $timeout How long to block for an element. * * @return Redis|string|false; * * @see https://redis.io/docs/latest/commands/blmove/ * * @example * @redis->lPush('numbers', 'one'); * @redis->blmove('numbers', 'odds', Redis::LEFT, Redis::LEFT 1.0); * // This call will block, if no additional elements are in 'numbers' * @redis->blmove('numbers', 'odds', Redis::LEFT, Redis::LEFT, 1.0); */ public function blmove(string $src, string $dst, string $wherefrom, string $whereto, float $timeout): Redis|string|false; /** * Pop one or more elements off a list. * * @param string $key The list to pop from. * @param int $count Optional number of elements to remove. By default one element is popped. * * @return Redis|bool|string|array Will return the element(s) popped from the list or false/NULL * if none was removed. * * @see https://redis.io/docs/latest/commands/lpop/ * * @example $redis->lpop('mylist'); * @example $redis->lpop('mylist', 4); */ public function lPop(string $key, int $count = 0): Redis|bool|string|array; /** * Retrieve the index of an element in a list. * * @param string $key The list to query. * @param mixed $value The value to search for. * @param array|null $options Options to configure how the command operates * ```php * $options = [ * # How many matches to return. By default a single match is returned. * # If count is set to zero, it means unlimited. * 'COUNT' => * * # Specify which match you want returned. `RANK` 1 means "the first match" * # 2 means the second, and so on. If passed as a negative number the * # RANK is computed right to left, so a `RANK` of -1 means "the last match". * 'RANK' => * * # This argument allows you to limit how many elements Redis will search before * # returning. This is useful to prevent Redis searching very long lists while * # blocking the client. * 'MAXLEN => * ]; * ``` * * @return Redis|null|bool|int|array Returns one or more of the matching indexes, or null/false if none were found. * * @see https://redis.io/docs/latest/commands/lpos/ * * @example * $redis->lPos('queue', 'job-42'); * */ public function lPos(string $key, mixed $value, ?array $options = null): Redis|null|bool|int|array; /** * Prepend one or more elements to a list. * * @param string $key The list to prepend. * @param mixed ...$elements One or more elements to prepend. * * @return Redis|int|false The new length of the list after prepending. * * @see https://redis.io/docs/latest/commands/lpush/ * * @example $redis->lPush('mylist', 'cat', 'bear', 'aligator'); */ public function lPush(string $key, mixed ...$elements): Redis|int|false; /** * Append one or more elements to a list. * * @param string $key The list to append to. * @param mixed ...$elements one or more elements to append. * * @return Redis|int|false The new length of the list * * @see https://redis.io/docs/latest/commands/rpush/ * * @example $redis->rPush('mylist', 'xray', 'yankee', 'zebra'); */ public function rPush(string $key, mixed ...$elements): Redis|int|false; /** * Prepend an element to a list but only if the list exists * * @param string $key The key to prepend to. * @param mixed $value The value to prepend. * * @return Redis|int|false The new length of the list. * * @see https://redis.io/docs/latest/commands/lpushx/ * * @example * $redis->lPushx('queue', 'job-42'); * */ public function lPushx(string $key, mixed $value): Redis|int|false; /** * Append an element to a list but only if the list exists * * @param string $key The key to prepend to. * @param mixed $value The value to prepend. * * @return Redis|int|false The new length of the list. * * @see https://redis.io/docs/latest/commands/rpushx/ * * @example * $redis->rPushx('queue', 'job-99'); * */ public function rPushx(string $key, mixed $value): Redis|int|false; /** * Set a list element at an index to a specific value. * * @param string $key The list to modify. * @param int $index The position of the element to change. * @param mixed $value The new value. * * @return Redis|bool True if the list was modified. * * @see https://redis.io/docs/latest/commands/lset/ * * @example * $redis->lSet('queue', 0, 'job-42'); * */ public function lSet(string $key, int $index, mixed $value): Redis|bool; /** * Retrieve the last time Redis' database was persisted to disk. * * @return int The unix timestamp of the last save time * * @see https://redis.io/docs/latest/commands/lastsave/ * * @example * $redis->lastSave(); * */ public function lastSave(): int; /** * Get the element of a list by its index. * * @param string $key The key to query * @param int $index The index to check. * @return mixed The index or NULL/false if the element was not found. * * @see https://redis.io/docs/latest/commands/lindex/ * * @example * $redis->lindex('queue', 0); * */ public function lindex(string $key, int $index): mixed; /** * Retrieve elements from a list. * * @param string $key The list to query. * @param int $start The beginning index to retrieve. This number can be negative * meaning start from the end of the list. * @param int $end The end index to retrieve. This can also be negative to start * from the end of the list. * * @return Redis|array|false The range of elements between the indexes. * * @see https://redis.io/docs/latest/commands/lrange/ * * @example $redis->lrange('mylist', 0, -1); // the whole list * @example $redis->lrange('mylist', -2, -1); // the last two elements in the list. */ public function lrange(string $key, int $start , int $end): Redis|array|false; /** * Remove one or more matching elements from a list. * * @param string $key The list to truncate. * @param mixed $value The value to remove. * @param int $count How many elements matching the value to remove. * * @return Redis|int|false The number of elements removed. * * @see https://redis.io/docs/latest/commands/lrem/ * * @example * $redis->lrem('queue', 0, 'expired-job'); * */ public function lrem(string $key, mixed $value, int $count = 0): Redis|int|false; /** * Trim a list to a subrange of elements. * * @param string $key The list to trim * @param int $start The starting index to keep * @param int $end The ending index to keep. * * @return Redis|bool true if the list was trimmed. * * @see https://redis.io/docs/latest/commands/ltrim/ * * @example $redis->ltrim('mylist', 0, 3); // Keep the first four elements */ public function ltrim(string $key, int $start , int $end): Redis|bool; /** * Get one or more string keys. * * @param array $keys The keys to retrieve * @return Redis|array|false an array of keys with their values. * * @see https://redis.io/docs/latest/commands/mget/ * * @example $redis->mget(['key1', 'key2']); */ public function mget(array $keys): Redis|array|false; /** * Proxy for the Redis MIGRATE command. * * @param string $host The destination redis host. * @param int $port The destination redis port. * @param string|array $key The key or array of keys to migrate. * @param int $dstdb The destination database index. * @param int $timeout The timeout for the operation in * milliseconds. * @param bool $copy Whether to copy the key(s) or move * them. * @param bool $replace Whether to replace existing keys on * the destination. * @param mixed|null $credentials Optional credentials for * authenticating to the destination * server. * * @see https://redis.io/docs/latest/commands/migrate/ * * @example * $redis->connect('localhost', 6379); * $redis->set('foo', '6379_key'); * * // Move the key to localhost:9999 with a 5 second timeout * var_dump($redis->migrate('localhost', 9999, 'foo', 0, 5000)); */ public function migrate(string $host, int $port, string|array $key, int $dstdb, int $timeout, bool $copy = false, bool $replace = false, #[\SensitiveParameter] mixed $credentials = null): Redis|bool; /** * Move a key to a different database on the same redis instance. * * @param string $key The key to move * @return Redis|bool True if the key was moved * * @see https://redis.io/docs/latest/commands/move/ * * @example * $redis->move('cart:42', 1); * */ public function move(string $key, int $index): Redis|bool; /** * Set one or more string keys. * * @param array $key_values An array with keys and their values. * @return Redis|bool True if the keys could be set. * * @see https://redis.io/docs/latest/commands/mset/ * * @example $redis->mSet(['foo' => 'bar', 'baz' => 'bop']); */ public function mset(array $key_values): Redis|bool; /** * Set one or more keys and values with optional expiry information. * * @param array $key_vals An array of keys with their values. * @param int|float|array|null $expiry An optional array with expiry information. * @return Redis|int|false 1 if all keys were set, 0 if none were. * * @see https://redis.io/commands/msetex * * @example $redis->msetex(['foo' => 'bar', 'baz' => 'bop'], ['EX' => 60]); */ public function msetex(array $key_vals, int|float|array|null $expiry = null): Redis|int|false; /** * Set one or more string keys but only if none of the key exist. * * @param array $key_values An array of keys with their values. * * @return Redis|bool True if the keys were set and false if not. * * @see https://redis.io/docs/latest/commands/msetnx/ * * @example $redis->msetnx(['foo' => 'bar', 'baz' => 'bop']); */ public function msetnx(array $key_values): Redis|bool; /** * Begin a transaction. * * @param int $value The type of transaction to start. This can either be `Redis::MULTI` or * `Redis::PIPELINE'. * * @return Redis|bool True if the transaction could be started. * * @see https://redis.io/docs/latest/commands/multi/ * * @example * $redis->multi(); * $redis->set('foo', 'bar'); * $redis->get('foo'); * $redis->exec(); */ public function multi(int $value = Redis::MULTI): bool|Redis; /** * Get encoding and other information about a key. * * @param string $subcommand The subcommand to execute. This can be either 'encoding', 'freq', or 'idle'. * @param string $key The key to query. * * @return Redis|int|string|false The requested information about the key. * * @example * $redis->del('list1'); * $redis->rPush('list1', 'a', 'b', 'c'); * echo $redis->object('encoding', 'list1'); * */ public function object(string $subcommand, string $key): Redis|int|string|false; /** * @deprecated * @alias Redis::connect * * @example * $redis->open('127.0.0.1', 6379); * */ public function open(string $host, int $port = 6379, float $timeout = 0, ?string $persistent_id = null, int $retry_interval = 0, float $read_timeout = 0, ?array $context = null): bool; /** * Connects to a Redis server creating or reusing a persistent connection. * * @param string $host The Redis server hostname. * @param int $port The Redis server port. * @param float $timeout Connection timeout in seconds. * @param string|null $persistent_id An optional persistent ID to use for the connection. * @param int $retry_interval The number of microseconds to wait before retrying a connection. * @param float $read_timeout Read timeout in seconds. * @param array|null $context An optional stream context array. * * @return bool True if the connection was successful. * * @throws RedisException * * @example * try { * $redis = new Redis(); * $redis->pconnect('localhost', 6379); * } catch (Exception $ex) { * echo "Could not connect to Redis: ", $ex->getMessage(), "\n"; * } */ public function pconnect(string $host, int $port = 6379, float $timeout = 0, ?string $persistent_id = null, int $retry_interval = 0, float $read_timeout = 0, ?array $context = null): bool; /** * Remove the expiration from a key. * * @param string $key The key to operate against. * * @return Redis|bool True if a timeout was removed and false if it was not or the key didn't exist. * * @see https://redis.io/docs/latest/commands/persist/ * * @example * $redis->persist('session:42'); * */ public function persist(string $key): Redis|bool; /** * Sets an expiration in milliseconds on a given key. If connected to Redis >= 7.0.0 * you can pass an optional mode argument that modifies how the command will execute. * * @see Redis::expire() for a description of the mode argument. * @see https://redis.io/docs/latest/commands/pexpire/ * * @param string $key The key to set an expiration on. * @param int $timeout The number of milliseconds after which key will be automatically deleted. * @param string|null $mode A two character modifier that changes how the * command works. * * @return bool True if an expiry was set on the key, and false otherwise. * * @example * $redis->pexpire('session:42', 5000); * */ public function pexpire(string $key, int $timeout, ?string $mode = null): bool; /** * Set a key's expiration to a specific Unix Timestamp in milliseconds. If connected to * Redis >= 7.0.0 you can pass an optional 'mode' argument. * * @see Redis::expire() For a description of the mode argument. * @see https://redis.io/docs/latest/commands/pexpireat/ * * @param string $key The key to set an expiration on. * @param int $timestamp The unix timestamp to expire at. * @param string|null $mode A two character modifier that changes how the * command works. * * @return Redis|bool True if an expiration was set on the key, false otherwise. * * @example * $redis->pexpireAt('session:42', (int) (microtime(true) * 1000) + 60000); * */ public function pexpireAt(string $key, int $timestamp, ?string $mode = null): Redis|bool; /** * Add one or more elements to a Redis HyperLogLog key * * @see https://redis.io/docs/latest/commands/pfadd/ * * @param string $key The key in question. * * @param array $elements One or more elements to add. * * @return Redis|int Returns 1 if the set was altered, and zero if not. * * @example * $redis->pfadd('visitors', ['alice', 'bob']); * */ public function pfadd(string $key, array $elements): Redis|int; /** * Retrieve the cardinality of a Redis HyperLogLog key. * * @see https://redis.io/docs/latest/commands/pfcount/ * * @param array|string $key_or_keys Either one key or an array of keys * * @return Redis|int|false The estimated cardinality of the set. * * @example * $redis->pfcount(['visitors:today', 'visitors:yesterday']); * */ public function pfcount(array|string $key_or_keys): Redis|int|false; /** * Merge one or more source HyperLogLog sets into a destination set. * * @see https://redis.io/docs/latest/commands/pfmerge/ * * @param string $dst The destination key. * @param array $srckeys One or more source keys. * * @return Redis|bool Always returns true. * * @example * $redis->pfmerge('visitors:all', ['visitors:today', 'visitors:yesterday']); * */ public function pfmerge(string $dst, array $srckeys): Redis|bool; /** * PING the redis server with an optional string argument. * * @see https://redis.io/docs/latest/commands/ping/ * * @param string|null $message An optional string message that Redis will reply with, if passed. * * @return Redis|string|false If passed no message, this command will simply return `true`. * If a message is passed, it will return the message. * * @example $redis->ping(); * @example $redis->ping('beep boop'); */ public function ping(?string $message = null): Redis|string|bool; /** * Enter into pipeline mode. * * Pipeline mode is the highest performance way to send many commands to Redis * as they are aggregated into one stream of commands and then all sent at once * when the user calls Redis::exec(). * * NOTE: That this is shorthand for Redis::multi(Redis::PIPELINE) * * @return bool|Redis The redis object is returned, to facilitate method chaining. * * @example * $redis->pipeline() * ->set('foo', 'bar') * ->del('mylist') * ->rpush('mylist', 'a', 'b', 'c') * ->exec(); */ public function pipeline(): bool|Redis; /** * @deprecated * @alias Redis::pconnect * * @example * $redis->popen('127.0.0.1', 6379, 0.0, 'cache'); * */ public function popen(string $host, int $port = 6379, float $timeout = 0, ?string $persistent_id = null, int $retry_interval = 0, float $read_timeout = 0, ?array $context = null): bool; /** * Set a key with an expiration time in milliseconds * * @param string $key The key to set * @param int $expire The TTL to set, in milliseconds. * @param mixed $value The value to set the key to. * * @return Redis|bool True if the key could be set. * * @see https://redis.io/docs/latest/commands/psetex/ * * @example $redis->psetex('mykey', 1000, 'myval'); */ public function psetex(string $key, int $expire, mixed $value): Redis|bool; /** * Subscribe to one or more glob-style patterns * * @param array $patterns One or more patterns to subscribe to. * @param callable $cb A callback with the following prototype: * * ```php * function ($redis, $channel, $message) { } * ``` * * @see https://redis.io/docs/latest/commands/psubscribe/ * * @return bool True if we were subscribed. * * @example * $redis->psubscribe(['user:*'], function (Redis $client, string $pattern, string $channel, string $message): void { * printf('[%s] %s' . PHP_EOL, $channel, $message); * }); * */ public function psubscribe(array $patterns, callable $cb): bool; /** * Get a keys time to live in milliseconds. * * @param string $key The key to check. * * @return Redis|int|false The key's TTL or one of two special values if it has none. * * -1 - The key has no TTL. * -2 - The key did not exist. * * * @see https://redis.io/docs/latest/commands/pttl/ * * @example $redis->pttl('ttl-key'); */ public function pttl(string $key): Redis|int|false; /** * Publish a message to a pubsub channel * * @see https://redis.io/docs/latest/commands/publish/ * * @param string $channel The channel to publish to. * @param string $message The message itself. * * @return Redis|int|false The number of subscribed clients to the given channel. * * @example * $redis->publish('updates', 'build complete'); * */ public function publish(string $channel, string $message): Redis|int|false; /** * Interact with the Redis PubSub subsystem. * * @param string $command The PubSub command to execute. This can be one of: * @param mixed $arg An optional argument to the command. * * @return mixed Can return any number of things depending on the command executed. * @see https://redis.io/docs/latest/commands/pubsub/ * * @example * $redis->pubsub('channels'); */ public function pubsub(string $command, mixed $arg = null): mixed; /** * Unsubscribe from one or more channels by pattern * * @see https://redis.io/docs/latest/commands/punsubscribe/ * @see https://redis.io/docs/latest/commands/subscribe/ * @see Redis::subscribe() * * @param array $patterns One or more glob-style patterns of channel names. * * @return Redis|array|bool The array of subscribed patterns or false on failure. * * @example * $redis->punsubscribe(['user:*', 'room:*']); * */ public function punsubscribe(array $patterns): Redis|array|bool; /** * Pop one or more elements from the end of a list. * * @param string $key A redis LIST key name. * @param int $count The maximum number of elements to pop at once. * NOTE: The `count` argument requires Redis >= 6.2.0 * * @return Redis|array|string|bool One or more popped elements or false if all were empty. * * @see https://redis.io/docs/latest/commands/rpop/ * * @example $redis->rPop('mylist'); * @example $redis->rPop('mylist', 4); */ public function rPop(string $key, int $count = 0): Redis|array|string|bool; /** * Return a random key from the current database * * @see https://redis.io/docs/latest/commands/randomkey/ * * @return Redis|string|false A random key name or false if no keys exist * * @example * $redis->randomKey(); * */ public function randomKey(): Redis|string|false; /** * Execute any arbitrary Redis command by name. * * @param string $command The command to execute * @param mixed ...$args One or more arguments to pass to the command. * * @return mixed Can return any number of things depending on command executed. * * @example $redis->rawCommand('del', 'mystring', 'mylist'); * @example $redis->rawCommand('set', 'mystring', 'myvalue'); * @example $redis->rawCommand('rpush', 'mylist', 'one', 'two', 'three'); */ public function rawcommand(string $command, mixed ...$args): mixed; /** * Unconditionally rename a key from $old_name to $new_name * * @see https://redis.io/docs/latest/commands/rename/ * * @param string $old_name The original name of the key * @param string $new_name The new name for the key * * @return Redis|bool True if the key was renamed or false if not. * * @example * $redis->rename('config:pending', 'config:active'); * */ public function rename(string $old_name, string $new_name): Redis|bool; /** * Renames $key_src to $key_dst but only if newkey does not exist. * * @see https://redis.io/docs/latest/commands/renamenx/ * * @param string $key_src The source key name * @param string $key_dst The destination key name. * * @return Redis|bool True if the key was renamed, false if not. * * @example * $redis->set('src', 'src_key'); * $redis->set('existing-dst', 'i_exist'); * * $redis->renamenx('src', 'dst'); * $redis->renamenx('dst', 'existing-dst'); */ public function renameNx(string $key_src, string $key_dst): Redis|bool; /** * Reset the state of the connection. * * @return Redis|bool Should always return true unless there is an error. * * @see https://redis.io/docs/latest/commands/reset/ * * @example * $redis->reset(); * */ public function reset(): Redis|bool; /** * Restore a key by the binary payload generated by the DUMP command. * * @param string $key The name of the key you wish to create. * @param int $ttl What Redis should set the key's TTL (in milliseconds) to once it is created. * Zero means no TTL at all. * @param string $value The serialized binary value of the string (generated by DUMP). * @param array|null $options An array of additional options that modifies how the command operates. * * ```php * $options = [ * 'ABSTTL' # If this is present, the `$ttl` provided by the user should * # be an absolute timestamp, in milliseconds() * * 'REPLACE' # This flag instructs Redis to store the key even if a key with * # that name already exists. * * 'IDLETIME' => int # Tells Redis to set the keys internal 'idletime' value to a * # specific number (see the Redis command OBJECT for more info). * 'FREQ' => int # Tells Redis to set the keys internal 'FREQ' value to a specific * # number (this relates to Redis' LFU eviction algorithm). * ]; * ``` * * @return Redis|bool True if the key was stored, false if not. * * @see https://redis.io/docs/latest/commands/restore/ * @see https://redis.io/docs/latest/commands/dump/ * @see Redis::dump() * * @example * $redis->sAdd('captains', 'Janeway', 'Picard', 'Sisko', 'Kirk', 'Archer'); * $serialized = $redis->dump('captains'); * * $redis->restore('captains-backup', 0, $serialized); */ public function restore(string $key, int $ttl, string $value, ?array $options = null): Redis|bool; /** * Query whether the connected instance is a primary or replica * * @return mixed Will return an array with the role of the connected instance unless there is * an error. * * @see https://redis.io/docs/latest/commands/role/ * * @example * $redis->role(); * */ public function role(): mixed; /** * Atomically pop an element off the end of a Redis LIST and push it to the beginning of * another. * * @param string $srckey The source key to pop from. * @param string $dstkey The destination key to push to. * * @return Redis|string|false The popped element or false if the source key was empty. * * @see https://redis.io/docs/latest/commands/rpoplpush/ * * @example * $redis->pipeline() * ->del('list1', 'list2') * ->rpush('list1', 'list1-1', 'list1-2') * ->rpush('list2', 'list2-1', 'list2-2') * ->exec(); * * $redis->rpoplpush('list2', 'list1'); */ public function rpoplpush(string $srckey, string $dstkey): Redis|string|false; /** * Add one or more values to a Redis SET key. * * @param string $key The key name * @param mixed $value A value to add to the set. * @param mixed ...$other_values One or more additional values to add * * @return Redis|int|false The number of values added to the set. * * @see https://redis.io/docs/latest/commands/sadd/ * * @example * $redis->del('myset'); * * $redis->sadd('myset', 'foo', 'bar', 'baz'); * $redis->sadd('myset', 'foo', 'new'); */ public function sAdd(string $key, mixed $value, mixed ...$other_values): Redis|int|false; /** * Add one or more values to a Redis SET key. This is an alternative to Redis::sadd() but * instead of being variadic, takes a single array of values. * * @see https://redis.io/docs/latest/commands/sadd/ * @see Redis::sadd() * * @param string $key The set to add values to. * @param array $values One or more members to add to the set. * * @return int The number of members added to the set. * * @example * $redis->del('myset'); * * $redis->sAddArray('myset', ['foo', 'bar', 'baz']); * $redis->sAddArray('myset', ['foo', 'new']); */ public function sAddArray(string $key, array $values): int; /** * Given one or more Redis SETS, this command returns all of the members from the first * set that are not in any subsequent set. * * @param string $key The first set * @param string ...$other_keys One or more additional sets * * @return Redis|array|false Returns the elements from keys 2..N that don't exist in the * first sorted set, or false on failure. * * @see https://redis.io/docs/latest/commands/sdiff/ * * @example * $redis->pipeline() * ->del('set1', 'set2', 'set3') * ->sadd('set1', 'apple', 'banana', 'carrot', 'date') * ->sadd('set2', 'carrot') * ->sadd('set3', 'apple', 'carrot', 'eggplant') * ->exec(); * * $redis->sdiff('set1', 'set2', 'set3'); */ public function sDiff(string $key, string ...$other_keys): Redis|array|false; /** * This method performs the same operation as SDIFF except it stores the resulting diff * values in a specified destination key. * * @see https://redis.io/docs/latest/commands/sdiffstore/ * @see Redis::sdiff() * * @param string $dst The key where to store the result * @param string $key The first key to perform the DIFF on * @param string ...$other_keys One or more additional keys. * * @return Redis|int|false The number of values stored in the destination set or false on failure. * * @example * $redis->sDiffStore('diff:set', 'set:all', 'set:archived'); * */ public function sDiffStore(string $dst, string $key, string ...$other_keys): Redis|int|false; /** * Given one or more Redis SET keys, this command will return all of the elements that are * in every one. * * @see https://redis.io/docs/latest/commands/sinter/ * * @param array|string $key The first SET key to intersect. * @param string ...$other_keys One or more Redis SET keys. * * @example * $redis->pipeline() * ->del('alice_likes', 'bob_likes', 'bill_likes') * ->sadd('alice_likes', 'asparagus', 'broccoli', 'carrot', 'potato') * ->sadd('bob_likes', 'asparagus', 'carrot', 'potato') * ->sadd('bill_likes', 'broccoli', 'potato') * ->exec(); * * var_dump($redis->sinter('alice_likes', 'bob_likes', 'bill_likes')); */ public function sInter(array|string $key, string ...$other_keys): Redis|array|false; /** * Compute the intersection of one or more sets and return the cardinality of the result. * * @param array $keys One or more set key names. * @param int $limit A maximum cardinality to return. This is useful to put an upper bound * on the amount of work Redis will do. * * @return Redis|int|false The * * @see https://redis.io/docs/latest/commands/sintercard/ * * @example * $redis->sAdd('set1', 'apple', 'pear', 'banana', 'carrot'); * $redis->sAdd('set2', 'apple', 'banana'); * $redis->sAdd('set3', 'pear', 'banana'); * * $redis->sInterCard(['set1', 'set2', 'set3']); */ public function sintercard(array $keys, int $limit = -1): Redis|int|false; /** * Perform the intersection of one or more Redis SETs, storing the result in a destination * key, rather than returning them. * * @param array|string $key Either a string key, or an array of keys (with at least two * elements, consisting of the destination key name and one * or more source keys names. * @param string ...$other_keys If the first argument was a string, subsequent arguments should * be source key names. * * @return Redis|int|false The number of values stored in the destination key or false on failure. * * @see https://redis.io/docs/latest/commands/sinterstore/ * @see Redis::sinter() * * @example * $redis->sInterStore(['dst', 'src1', 'src2', 'src3']); * $redis->sInterStore('dst', 'src1', 'src'2', 'src3'); */ public function sInterStore(array|string $key, string ...$other_keys): Redis|int|false; /** * Retrieve every member from a set key. * * @param string $key The set name. * * @return Redis|array|false Every element in the set or false on failure. * * @see https://redis.io/docs/latest/commands/smembers/ * * @example * $redis->sAdd('tng-crew', ...['Picard', 'Riker', 'Data', 'Worf', 'La Forge', 'Troi', 'Crusher', 'Broccoli']); * $redis->sMembers('tng-crew'); */ public function sMembers(string $key): Redis|array|false; /** * Check if one or more values are members of a set. * * @see https://redis.io/docs/latest/commands/smismember/ * @see https://redis.io/docs/latest/commands/smember/ * @see Redis::smember() * * @param string $key The set to query. * @param string $member The first value to test if exists in the set. * @param string ...$other_members Any number of additional values to check. * * @return Redis|array|false An array of integers representing whether each passed value * was a member of the set. * * @example * $redis->sAdd('ds9-crew', ...["Sisko", "Kira", "Dax", "Worf", "Bashir", "O'Brien"]); * $members = $redis->sMIsMember('ds9-crew', ...['Sisko', 'Picard', 'Data', 'Worf']); */ public function sMisMember(string $key, string $member, string ...$other_members): Redis|array|false; /** * Pop a member from one set and push it onto another. This command will create the * destination set if it does not currently exist. * * @see https://redis.io/docs/latest/commands/smove/ * * @param string $src The source set. * @param string $dst The destination set. * @param mixed $value The member you wish to move. * * @return Redis|bool True if the member was moved, and false if it wasn't in the set. * * @example * $redis->sAdd('numbers', 'zero', 'one', 'two', 'three', 'four'); * $redis->sMove('numbers', 'evens', 'zero'); * $redis->sMove('numbers', 'evens', 'two'); * $redis->sMove('numbers', 'evens', 'four'); */ public function sMove(string $src, string $dst, mixed $value): Redis|bool; /** * Remove one or more elements from a set. * * @see https://redis.io/docs/latest/commands/spop/ * * @param string $key The set in question. * @param int $count An optional number of members to pop. This defaults to * removing one element. * * @example * $redis->del('numbers', 'evens'); * $redis->sAdd('numbers', 'zero', 'one', 'two', 'three', 'four'); * $redis->sPop('numbers'); */ public function sPop(string $key, int $count = 0): Redis|string|array|false; /** * Retrieve one or more random members of a set. * * @param string $key The set to query. * @param int $count An optional count of members to return. * * If this value is positive, Redis will return *up to* the requested * number but with unique elements that will never repeat. This means * you may receive fewer then `$count` replies. * * If the number is negative, Redis will return the exact number requested * but the result may contain duplicate elements. * * @return Redis|array|string|false One or more random members or false on failure. * * @see https://redis.io/docs/latest/commands/srandmember/ * * @example $redis->sRandMember('myset'); * @example $redis->sRandMember('myset', 10); * @example $redis->sRandMember('myset', -10); */ public function sRandMember(string $key, int $count = 0): mixed; /** * Returns the union of one or more Redis SET keys. * * @see https://redis.io/docs/latest/commands/sunion/ * * @param string $key The first SET to do a union with * @param string ...$other_keys One or more subsequent keys * * @return Redis|array|false The union of the one or more input sets or false on failure. * * @example $redis->sunion('set1', 'set2'); */ public function sUnion(string $key, string ...$other_keys): Redis|array|false; /** * Perform a union of one or more Redis SET keys and store the result in a new set * * @see https://redis.io/docs/latest/commands/sunionstore/ * @see Redis::sunion() * * @param string $dst The destination key * @param string $key The first source key * @param string ...$other_keys One or more additional source keys * * @return Redis|int|false The number of elements stored in the destination SET or * false on failure. * * @example * $redis->sUnionStore('union:set', 'set:a', 'set:b'); * */ public function sUnionStore(string $dst, string $key, string ...$other_keys): Redis|int|false; /** * Persist the Redis database to disk. This command will block the server until the save is * completed. For a nonblocking alternative, see Redis::bgsave(). * * @see https://redis.io/docs/latest/commands/save/ * @see Redis::bgsave() * * @return Redis|bool Returns true unless an error occurs. * * @example * $redis->save(); * */ public function save(): Redis|bool; /** * Incrementally scan the Redis keyspace, with optional pattern and type matching. * * A note about Redis::SCAN_NORETRY and Redis::SCAN_RETRY. * * For convenience, PhpRedis can retry SCAN commands itself when Redis returns an empty array of * keys with a nonzero iterator. This can happen when matching against a pattern that very few * keys match inside a key space with a great many keys. The following example demonstrates how * to use Redis::scan() with the option disabled and enabled. * * @param int|string|null $iterator The cursor returned by Redis for every subsequent call to SCAN. On * the initial invocation of the call, it should be initialized by the * caller to NULL. Each time SCAN is invoked, the iterator will be * updated to a new number, until finally Redis will set the value to * zero, indicating that the scan is complete. * @param string|null $pattern An optional glob-style pattern for matching key names. If passed as * NULL, it is the equivalent of sending '*' (match every key). * @param int $count A hint to redis that tells it how many keys to return in a single * call to SCAN. The larger the number, the longer Redis may block * clients while iterating the key space. * @param string|null $type An optional argument to specify which key types to scan (e.g. * 'STRING', 'LIST', 'SET') * * @return array|false An array of keys, or false if no keys were returned for this * invocation of scan. Note that it is possible for Redis to return * zero keys before having scanned the entire key space, so the caller * should instead continue to SCAN until the iterator reference is * returned to zero. * * @see https://redis.io/docs/latest/commands/scan/ * @see Redis::setOption() * * @example * $redis = new Redis(['host' => 'localhost']); * * $redis->setOption(Redis::OPT_SCAN, Redis::SCAN_NORETRY); * * $it = null; * * do { * $keys = $redis->scan($it, '*zorg*'); * foreach ($keys as $key) { * echo "KEY: $key\n"; * } * } while ($it != 0); * * $redis->setOption(Redis::OPT_SCAN, Redis::SCAN_RETRY); * * $it = null; * * // When Redis::SCAN_RETRY is enabled, we can use simpler logic, as we will never receive an * // empty array of keys when the iterator is nonzero. * while ($keys = $redis->scan($it, '*zorg*')) { * foreach ($keys as $key) { * echo "KEY: $key\n"; * } * } */ public function scan(null|int|string &$iterator, ?string $pattern = null, int $count = 0, ?string $type = null): array|false; /** * Retrieve the number of members in a Redis set. * * @param string $key The set to get the cardinality of. * * @return Redis|int|false The cardinality of the set or false on failure. * * @see https://redis.io/docs/latest/commands/scard/ * * @example $redis->scard('set'); */ public function scard(string $key): Redis|int|false; /** * An administrative command used to interact with LUA scripts stored on the server. * * @see https://redis.io/docs/latest/commands/script/ * * @param string $command The script suboperation to execute. * @param mixed ...$args One or more additional argument * * @return mixed This command returns various things depending on the specific operation executed. * * @example $redis->script('load', 'return 1'); * @example $redis->script('exists', sha1('return 1')); */ public function script(string $command, mixed ...$args): mixed; /** * Select a specific Redis database. * * @param int $db The database to select. Note that by default Redis has 16 databases (0-15). * * @return Redis|bool true on success and false on failure * * @see https://redis.io/docs/latest/commands/select/ * * @example $redis->select(1); */ public function select(int $db): Redis|bool; /** * Create or set a Redis STRING key to a value. * * @param string $key The key name to set. * @param mixed $value The value to set the key to. * @param array|int $options Either an array with options for how to perform the set or an * integer with an expiration. If an expiration is set PhpRedis * will actually send the `SETEX` command. * * OPTION DESCRIPTION * ------------ -------------------------------------------------------------- * ['EX' => 60] expire 60 seconds. * ['PX' => 6000] expire in 6000 milliseconds. * ['EXAT' => time() + 10] expire in 10 seconds. * ['PXAT' => time()*1000 + 1000] expire in 1 second. * ['KEEPTTL' => true] Redis will not update the key's current TTL. * ['XX'] Only set the key if it already exists. * ['NX'] Only set the key if it doesn't exist. * ['GET'] Instead of returning `+OK` return the previous value of the * key or NULL if the key didn't exist. * * @return Redis|string|bool True if the key was set or false on failure. * * @see https://redis.io/docs/latest/commands/set/ * @see https://redis.io/docs/latest/commands/setex/ * * @example $redis->set('key', 'value'); * @example $redis->set('key', 'expires_in_60_seconds', 60); */ public function set(string $key, mixed $value, mixed $options = null): Redis|string|bool; /** * Set a specific bit in a Redis string to zero or one * * @see https://redis.io/docs/latest/commands/setbit/ * * @param string $key The Redis STRING key to modify * @param bool $value Whether to set the bit to zero or one. * * @return Redis|int|false The original value of the bit or false on failure. * * @example * $redis->set('foo', 'bar'); * $redis->setbit('foo', 7, 1); */ public function setBit(string $key, int $idx, bool $value): Redis|int|false; /** * Update or append to a Redis string at a specific starting index * * @see https://redis.io/docs/latest/commands/setrange/ * * @param string $key The key to update * @param int $index Where to insert the provided value * @param string $value The value to copy into the string. * * @return Redis|int|false The new length of the string or false on failure * * @example * $redis->set('message', 'Hello World'); * $redis->setRange('message', 6, 'Redis'); */ public function setRange(string $key, int $index, string $value): Redis|int|false; /** * Set a configurable option on the Redis object. * * Following are a list of options you can set: * * | OPTION | TYPE | DESCRIPTION | * | --------------- | ---- | ----------- | * | OPT_MAX_RETRIES | int | The maximum number of times Redis will attempt to reconnect if it gets disconnected, before throwing an exception. | * | OPT_SCAN | enum | Redis::OPT_SCAN_RETRY, or Redis::OPT_SCAN_NORETRY. Whether PhpRedis should automatically SCAN again when zero keys but a nonzero iterator are returned. | * | OPT_SERIALIZER | enum | Set the automatic data serializer.
`Redis::SERIALIZER_NONE`
`Redis::SERIALIZER_PHP`
`Redis::SERIALIZER_IGBINARY`
`Redis::SERIALIZER_MSGPACK`, `Redis::SERIALIZER_JSON`| * | OPT_PREFIX | string | A string PhpRedis will use to prefix every key we read or write. | * | OPT_READ_TIMEOUT | float | How long PhpRedis will block for a response from Redis before throwing a 'read error on connection' exception. | * | OPT_TCP_KEEPALIVE | bool | Set or disable TCP_KEEPALIVE on the connection. | * | OPT_COMPRESSION | enum | Set the compression algorithm
`Redis::COMPRESSION_NONE`
`Redis::COMPRESSION_LZF`
`Redis::COMPRESSION_LZ4`
`Redis::COMPRESSION_ZSTD` | * | OPT_REPLY_LITERAL | bool | If set to true, PhpRedis will return the literal string Redis returns for LINE replies (e.g. '+OK'), rather than `true`. | * | OPT_COMPRESSION_LEVEL | int | Set a specific compression level if Redis is compressing data. | * | OPT_NULL_MULTIBULK_AS_NULL | bool | Causes PhpRedis to return `NULL` rather than `false` for NULL MULTIBULK replies | * | OPT_BACKOFF_ALGORITHM | enum | The exponential backoff strategy to use. | * | OPT_BACKOFF_BASE | int | The minimum delay between retries when backing off. | * | OPT_BACKOFF_CAP | int | The maximum delay between replies when backing off. | * * @see Redis::getOption() * @see Redis::__construct() for details about backoff strategies. * * @param int $option The option constant. * @param mixed $value The option value. * * @return bool true if the setting was updated, false if not. * * @example * $redis->setOption(Redis::OPT_PREFIX, 'app:'); * */ public function setOption(int $option, mixed $value): bool; /** * Set a Redis STRING key with a specific expiration in seconds. * * @param string $key The name of the key to set. * @param int $expire The key's expiration in seconds. * @param mixed $value The value to set the key. * * @return Redis|bool True on success or false on failure. * * @see https://redis.io/docs/latest/commands/setex/ * * @example $redis->setex('60s-ttl', 60, 'some-value'); */ public function setex(string $key, int $expire, mixed $value); /** * Set a key to a value, but only if that key does not already exist. * * @see https://redis.io/docs/latest/commands/setnx/ * * @param string $key The key name to set. * @param mixed $value What to set the key to. * * @return Redis|bool Returns true if the key was set and false otherwise. * * @example $redis->setnx('existing-key', 'existing-value'); * @example $redis->setnx('new-key', 'new-value'); */ public function setnx(string $key, mixed $value): Redis|bool; /** * Check whether a given value is the member of a Redis SET. * * @param string $key The redis set to check. * @param mixed $value The value to test. * * @return Redis|bool True if the member exists and false if not. * * @see https://redis.io/docs/latest/commands/sismember/ * * @example $redis->sismember('myset', 'mem1', 'mem2'); */ public function sismember(string $key, mixed $value): Redis|bool; /** * Turn a redis instance into a replica of another or promote a replica * to a primary. * * This method and the corresponding command in Redis has been marked deprecated * and users should instead use Redis::replicaof() if connecting to redis-server * >= 5.0.0. * * @deprecated * * @see https://redis.io/docs/latest/commands/slaveof/ * @see https://redis.io/docs/latest/commands/replicaof/ * @see Redis::replicaof() * * @example * $redis->slaveof('10.0.0.5', 6380); * */ public function slaveof(?string $host = null, int $port = 6379): Redis|bool; /** * Used to turn a Redis instance into a replica of another, or to remove * replica status promoting the instance to a primary. * * @see https://redis.io/docs/latest/commands/replicaof/ * @see https://redis.io/docs/latest/commands/slaveof/ * @see Redis::slaveof() * * @param string|null $host The host of the primary to start replicating. * @param int $port The port of the primary to start replicating. * * @return Redis|bool Success if we were successfully able to start replicating a primary or * were able to promote the replicat to a primary. * * @example * $redis = new Redis(['host' => 'localhost']); * * // Attempt to become a replica of a Redis instance at 127.0.0.1:9999 * $redis->replicaof('127.0.0.1', 9999); * * // When passed no arguments, PhpRedis will deliver the command `REPLICAOF NO ONE` * // attempting to promote the instance to a primary. * $redis->replicaof(); */ public function replicaof(?string $host = null, int $port = 6379): Redis|bool; /** * Update one or more keys last modified metadata. * * @see https://redis.io/docs/latest/commands/touch/ * * @param array|string $key_or_array Either the first key or if passed as the only argument * an array of keys. * @param string ...$more_keys One or more keys to send to the command. * * @return Redis|int|false This command returns the number of keys that exist and * had their last modified time reset * * @example * $redis->touch('cache:1', 'cache:2'); * */ public function touch(array|string $key_or_array, string ...$more_keys): Redis|int|false; /** * Interact with Redis' slowlog functionality in various ways, depending * on the value of 'operation'. * * @category administration * * @param string $operation The operation you wish to perform.  This can * be one of the following values: * 'GET' - Retrieve the Redis slowlog as an array. * 'LEN' - Retrieve the length of the slowlog. * 'RESET' - Remove all slowlog entries. * @param int $length This optional argument can be passed when operation * is 'get' and will specify how many elements to retrieve. * If omitted Redis will send up to a default number of * entries, which is configurable. * * Note: With Redis >= 7.0.0 you can send -1 to mean "all". * * @return mixed * * @see https://redis.io/docs/latest/commands/slowlog/ * * @example $redis->slowlog('get', -1); // Retrieve all slowlog entries. * @example $redis->slowlog('len'); // Retrieve slowlog length. * @example $redis->slowlog('reset'); // Reset the slowlog. */ public function slowlog(string $operation, int $length = 0): mixed; /** * Sort the contents of a Redis key in various ways. * * @see https://redis.io/docs/latest/commands/sort/ * * @param string $key The key you wish to sort * @param array|null $options Various options controlling how you would like the * data sorted. See blow for a detailed description * of this options array. * * @return mixed This command can either return an array with the sorted data * or the number of elements placed in a destination set when * using the STORE option. * * @example * $options = [ * 'SORT' => 'ASC'|| 'DESC' // Sort in descending or descending order. * 'ALPHA' => true || false // Whether to sort alphanumerically. * 'LIMIT' => [0, 10] // Return a subset of the data at offset, count * 'BY' => 'weight_*' // For each element in the key, read data from the * external key weight_* and sort based on that value. * 'GET' => 'weight_*' // For each element in the source key, retrieve the * data from key weight_* and return that in the result * rather than the source keys' element. This can * be used in combination with 'BY' * ]; */ public function sort(string $key, ?array $options = null): mixed; /** * This is simply a read-only variant of the sort command * * @see Redis::sort() * @see https://redis.io/docs/latest/commands/sort_ro/ * * @example * $redis->sort_ro('numbers', ['LIMIT' => [0, 5]]); * */ public function sort_ro(string $key, ?array $options = null): mixed; /** * @deprecated * * @see https://redis.io/docs/latest/commands/sort/ * * @example * $redis->sortAsc('numbers'); * */ public function sortAsc(string $key, ?string $pattern = null, mixed $get = null, int $offset = -1, int $count = -1, ?string $store = null): array; /** * @deprecated * * @see https://redis.io/docs/latest/commands/sort/ * * @example * $redis->sortAscAlpha('tags'); * */ public function sortAscAlpha(string $key, ?string $pattern = null, mixed $get = null, int $offset = -1, int $count = -1, ?string $store = null): array; /** * @deprecated * * @see https://redis.io/docs/latest/commands/sort/ * * @example * $redis->sortDesc('numbers'); * */ public function sortDesc(string $key, ?string $pattern = null, mixed $get = null, int $offset = -1, int $count = -1, ?string $store = null): array; /** * @deprecated * * @see https://redis.io/docs/latest/commands/sort/ * * @example * $redis->sortDescAlpha('tags'); * */ public function sortDescAlpha(string $key, ?string $pattern = null, mixed $get = null, int $offset = -1, int $count = -1, ?string $store = null): array; /** * Remove one or more values from a Redis SET key. * * @see https://redis.io/docs/latest/commands/srem/ * * @param string $key The Redis SET key in question. * @param mixed $value The first value to remove. * @param mixed ...$other_values One or more additional values to remove. * * @return Redis|int|false The number of values removed from the set or false on failure. * * @example $redis->sRem('set1', 'mem1', 'mem2', 'not-in-set'); */ public function srem(string $key, mixed $value, mixed ...$other_values): Redis|int|false; /** * Scan the members of a redis SET key. * * @see https://redis.io/docs/latest/commands/sscan/ * @see https://redis.io/docs/latest/commands/scan/ * @see Redis::setOption() * * @param string $key The Redis SET key in question. * @param int|string|null $iterator A reference to an iterator which should be initialized to NULL that * PhpRedis will update with the value returned from Redis after each * subsequent call to SSCAN. Once this cursor is zero you know all * members have been traversed. * @param string|null $pattern An optional glob style pattern to match against, so Redis only * returns the subset of members matching this pattern. * @param int $count A hint to Redis as to how many members it should scan in one command * before returning members for that iteration. * * @example * $redis->del('myset'); * for ($i = 0; $i < 10000; $i++) { * $redis->sAdd('myset', "member:$i"); * } * $redis->sadd('myset', 'foofoo'); * * $redis->setOption(Redis::OPT_SCAN, Redis::SCAN_NORETRY); * * $scanned = 0; * $it = null; * * // Without Redis::SCAN_RETRY we may receive empty results and * // a nonzero iterator. * do { * // Scan members containing '5' * $members = $redis->sscan('myset', $it, '*5*'); * foreach ($members as $member) { * echo "NORETRY: $member\n"; * $scanned++; * } * } while ($it != 0); * echo "TOTAL: $scanned\n"; * * $redis->setOption(Redis::OPT_SCAN, Redis::SCAN_RETRY); * * $scanned = 0; * $it = null; * * // With Redis::SCAN_RETRY PhpRedis will never return an empty array * // when the cursor is non-zero * while (($members = $redis->sscan('myset', $it, '*5*'))) { * foreach ($members as $member) { * echo "RETRY: $member\n"; * $scanned++; * } * } */ public function sscan(string $key, null|int|string &$iterator, ?string $pattern = null, int $count = 0): array|false; /** * Subscribes the client to the specified shard channels. * * @param array $channels One or more channel names. * @param callable $cb The callback PhpRedis will invoke when we receive a message * from one of the subscribed channels. * * @return bool True on success, false on faiilure. Note that this command will block the * client in a subscribe loop, waiting for messages to arrive. * * @see https://redis.io/docs/latest/commands/ssubscribe/ * * @example * $redis = new Redis(['host' => 'localhost']); * * $redis->ssubscribe(['channel-1', 'channel-2'], function ($redis, $channel, $message) { * echo "[$channel]: $message\n"; * * // Unsubscribe from the message channel when we read 'quit' * if ($message == 'quit') { * echo "Unsubscribing from '$channel'\n"; * $redis->sunsubscribe([$channel]); * } * }); * * // Once we read 'quit' from both channel-1 and channel-2 the subscribe loop will be * // broken and this command will execute. * echo "Subscribe loop ended\n"; */ public function ssubscribe(array $channels, callable $cb): bool; /** * Retrieve the length of a Redis STRING key. * * @param string $key The key we want the length of. * * @return Redis|int|false The length of the string key if it exists, zero if it does not, and * false on failure. * * @see https://redis.io/docs/latest/commands/strlen/ * * @example $redis->strlen('mykey'); */ public function strlen(string $key): Redis|int|false; /** * Subscribe to one or more Redis pubsub channels. * * @param array $channels One or more channel names. * @param callable $cb The callback PhpRedis will invoke when we receive a message * from one of the subscribed channels. * * @return bool True on success, false on faiilure. Note that this command will block the * client in a subscribe loop, waiting for messages to arrive. * * @see https://redis.io/docs/latest/commands/subscribe/ * * @example * $redis = new Redis(['host' => 'localhost']); * * $redis->subscribe(['channel-1', 'channel-2'], function ($redis, $channel, $message) { * echo "[$channel]: $message\n"; * * // Unsubscribe from the message channel when we read 'quit' * if ($message == 'quit') { * echo "Unsubscribing from '$channel'\n"; * $redis->unsubscribe([$channel]); * } * }); * * // Once we read 'quit' from both channel-1 and channel-2 the subscribe loop will be * // broken and this command will execute. * echo "Subscribe loop ended\n"; */ public function subscribe(array $channels, callable $cb): bool; /** * Unsubscribes the client from the given shard channels, * or from all of them if none is given. * * @param array $channels One or more channels to unsubscribe from. * @return Redis|array|bool The array of unsubscribed channels. * * @see https://redis.io/docs/latest/commands/sunsubscribe/ * @see Redis::ssubscribe() * * @example * $redis->ssubscribe(['channel-1', 'channel-2'], function ($redis, $channel, $message) { * if ($message == 'quit') { * echo "$channel => 'quit' detected, unsubscribing!\n"; * $redis->sunsubscribe([$channel]); * } else { * echo "$channel => $message\n"; * } * }); * * echo "We've unsubscribed from both channels, exiting\n"; */ public function sunsubscribe(array $channels): Redis|array|bool; /** * Atomically swap two Redis databases so that all of the keys in the source database will * now be in the destination database and vice-versa. * * Note: This command simply swaps Redis' internal pointer to the database and is therefore * very fast, regardless of the size of the underlying databases. * * @param int $src The source database number * @param int $dst The destination database number * * @return Redis|bool Success if the databases could be swapped and false on failure. * * @see https://redis.io/docs/latest/commands/swapdb/ * @see Redis::del() * * @example * $redis->select(0); * $redis->set('db0-key', 'db0-value'); * $redis->swapdb(0, 1); * $redis->get('db0-key'); */ public function swapdb(int $src, int $dst): Redis|bool; /** * Retrieve the server time from the connected Redis instance. * * @see https://redis.io/docs/latest/commands/time/ * * @return Redis|array A two element array consisting of a Unix Timestamp and the number of microseconds * elapsed since the second. * * @example $redis->time(); */ public function time(): Redis|array; /** * Get the amount of time a Redis key has before it will expire, in seconds. * * @param string $key The Key we want the TTL for. * @return Redis|int|false (a) The number of seconds until the key expires, or -1 if the key has * no expiration, and -2 if the key does not exist. In the event of an * error, this command will return false. * * @see https://redis.io/docs/latest/commands/ttl/ * * @example $redis->ttl('mykey'); */ public function ttl(string $key): Redis|int|false; /** * Get the type of a given Redis key. * * @see https://redis.io/docs/latest/commands/type/ * * @param string $key The key to check * @return Redis|int|false The Redis type constant or false on failure. * * The Redis class defines several type constants that correspond with Redis key types. * * Redis::REDIS_NOT_FOUND * Redis::REDIS_STRING * Redis::REDIS_SET * Redis::REDIS_LIST * Redis::REDIS_ZSET * Redis::REDIS_HASH * Redis::REDIS_STREAM * Redis::REDIS_VECTORSET * * @example * foreach ($redis->keys('*') as $key) { * echo "$key => " . $redis->type($key) . "\n"; * } */ public function type(string $key): Redis|int|false; /** * Delete one or more keys from the Redis database. Unlike this operation, the actual * deletion is asynchronous, meaning it is safe to delete large keys without fear of * Redis blocking for a long period of time. * * @param array|string $key Either an array with one or more keys or a string with * the first key to delete. * @param string ...$other_keys If the first argument passed to this method was a string * you may pass any number of additional key names. * * @return Redis|int|false The number of keys deleted or false on failure. * * @see https://redis.io/docs/latest/commands/unlink/ * @see https://redis.io/docs/latest/commands/del/ * @see Redis::del() * * @example $redis->unlink('key1', 'key2', 'key3'); * @example $redis->unlink(['key1', 'key2', 'key3']); */ public function unlink(array|string $key, string ...$other_keys): Redis|int|false; /** * Unsubscribe from one or more subscribed channels. * * @param array $channels One or more channels to unsubscribe from. * @return Redis|array|bool The array of unsubscribed channels. * * @see https://redis.io/docs/latest/commands/unsubscribe/ * @see Redis::subscribe() * * @example * $redis->subscribe(['channel-1', 'channel-2'], function ($redis, $channel, $message) { * if ($message == 'quit') { * echo "$channel => 'quit' detected, unsubscribing!\n"; * $redis->unsubscribe([$channel]); * } else { * echo "$channel => $message\n"; * } * }); * * echo "We've unsubscribed from both channels, exiting\n"; */ public function unsubscribe(array $channels): Redis|array|bool; /** * Remove any previously WATCH'ed keys in a transaction. * * @see https://redis.io/docs/latest/commands/unwatch/ * @see https://redis.io/docs/latest/commands/unwatch/ * @see Redis::watch() * * @return Redis|bool True on success and false on failure. * * @example * $redis->unwatch(); * */ public function unwatch(): Redis|bool; /** * Watch one or more keys for conditional execution of a transaction. * * @param array|string $key Either an array with one or more key names, or a string key name * @param string ...$other_keys If the first argument was passed as a string, any number of additional * string key names may be passed variadically. * * @return Redis|bool * * @see https://redis.io/docs/latest/commands/watch/ * @see https://redis.io/docs/latest/commands/unwatch/ * * @example * $redis1 = new Redis(['host' => 'localhost']); * $redis2 = new Redis(['host' => 'localhost']); * * // Start watching 'incr-key' * $redis1->watch('incr-key'); * * // Retrieve its value. * $val = $redis1->get('incr-key'); * * // A second client modifies 'incr-key' after we read it. * $redis2->set('incr-key', 0); * * // Because another client changed the value of 'incr-key' after we read it, this * // is no longer a proper increment operation, but because we are `WATCH`ing the * // key, this transaction will fail and we can try again. * // * // If were to comment out the above `$redis2->set('incr-key', 0)` line the * // transaction would succeed. * $redis1->multi(); * $redis1->set('incr-key', $val + 1); * $res = $redis1->exec(); * * // bool(false) * var_dump($res); */ public function watch(array|string $key, string ...$other_keys): Redis|bool; /** * Block the client up to the provided timeout until a certain number of replicas have confirmed * receiving them. * * @see https://redis.io/docs/latest/commands/wait/ * * @param int $numreplicas The number of replicas we want to confirm write operations * @param int $timeout How long to wait (zero meaning forever). * * @return int|false The number of replicas that have confirmed or false on failure. * * @example * $redis->wait(1, 1000); * */ public function wait(int $numreplicas, int $timeout): int|false; /** * Acknowledge one or more messages that are pending (have been consumed using XREADGROUP but * not yet acknowledged by XACK.) * * @param string $key The stream to query. * @param string $group The consumer group to use. * @param array $ids An array of stream entry IDs. * * @return int|false The number of acknowledged messages * * @see https://redis.io/docs/latest/commands/xack/ * @see https://redis.io/docs/latest/commands/xreadgroup/ * @see Redis::xack() * * @example * $redis->xAdd('ships', '*', ['name' => 'Enterprise']); * $redis->xAdd('ships', '*', ['name' => 'Defiant']); * * $redis->xGroup('CREATE', 'ships', 'Federation', '0-0'); * * // Consume a single message with the consumer group 'Federation' * $ship = $redis->xReadGroup('Federation', 'Picard', ['ships' => '>'], 1); * * /* Retrieve the ID of the message we read. * assert(isset($ship['ships'])); * $id = key($ship['ships']); * * // The message we just read is now pending. * $res = $redis->xPending('ships', 'Federation')); * var_dump($res); * * // We can tell Redis we were able to process the message by using XACK * $res = $redis->xAck('ships', 'Federation', [$id]); * assert($res === 1); * * // The message should no longer be pending. * $res = $redis->xPending('ships', 'Federation'); * var_dump($res); */ public function xack(string $key, string $group, array $ids): int|false; /** * Append a message to a stream. * * @param string $key The stream name. * @param string $id The ID for the message we want to add. This can be the special value '*' * which means Redis will generate the ID that appends the message to the * end of the stream. It can also be a value in the form -* which will * generate an ID that appends to the end of entries with the same value * (if any exist). * @param int $maxlen If specified Redis will append the new message but trim any number of the * oldest messages in the stream until the length is <= $maxlen. * @param bool $approx Used in conjunction with `$maxlen`, this flag tells Redis to trim the stream * but in a more efficient way, meaning the trimming may not be exactly to * `$maxlen` values. * @param bool $nomkstream If passed as `TRUE`, the stream must exist for Redis to append the message. * * @see https://redis.io/docs/latest/commands/xadd/ * * @example $redis->xAdd('ds9-season-1', '1-1', ['title' => 'Emissary Part 1']); * @example $redis->xAdd('ds9-season-1', '1-2', ['title' => 'A Man Alone']); */ public function xadd(string $key, string $id, array $values, int $maxlen = 0, bool $approx = false, bool $nomkstream = false): Redis|string|false; /** * This command allows a consumer to claim pending messages that have been idle for a specified period of time. * Its purpose is to provide a mechanism for picking up messages that may have had a failed consumer. * * @see https://redis.io/docs/latest/commands/xautoclaim/ * @see https://redis.io/docs/latest/commands/xclaim/ * @see https://redis.io/docs/data-types/streams-tutorial/ * * @param string $key The stream to check. * @param string $group The consumer group to query. * @param string $consumer Which consumer to check. * @param int $min_idle The minimum time in milliseconds for the message to have been pending. * @param string $start The minimum message id to check. * @param int $count An optional limit on how many messages are returned. * @param bool $justid If the client only wants message IDs and not all of their data. * * @return Redis|array|bool An array of pending IDs or false if there are none, or on failure. * * @example * $redis->xGroup('CREATE', 'ships', 'combatants', '0-0', true); * * $redis->xAdd('ships', '1424-74205', ['name' => 'Defiant']); * * // Consume the ['name' => 'Defiant'] message * $msgs = $redis->xReadGroup('combatants', "Jem'Hadar", ['ships' => '>'], 1); * * // The "Jem'Hadar" consumer has the message presently * $pending = $redis->xPending('ships', 'combatants'); * var_dump($pending); * * // Assume control of the pending message with a different consumer. * $res = $redis->xAutoClaim('ships', 'combatants', 'Sisko', 0, '0-0'); * * // Now the 'Sisko' consumer owns the message * $pending = $redis->xPending('ships', 'combatants'); * var_dump($pending); */ public function xautoclaim(string $key, string $group, string $consumer, int $min_idle, string $start, int $count = -1, bool $justid = false): Redis|bool|array; /** * This method allows a consumer to take ownership of pending stream entries, by ID. Another * command that does much the same thing but does not require passing specific IDs is `Redis::xAutoClaim`. * * @see https://redis.io/docs/latest/commands/xclaim/ * @see https://redis.io/docs/latest/commands/xautoclaim./ * * @param string $key The stream we wish to claim messages for. * @param string $group Our consumer group. * @param string $consumer Our consumer. * @param int $min_idle The minimum idle-time in milliseconds a message must have for ownership to be transferred. * @param array $options An options array that modifies how the command operates. * * ```php * # Following is an options array describing every option you can pass. Note that * # 'IDLE', and 'TIME' are mutually exclusive. * $options = [ * 'IDLE' => 3 # Set the idle time of the message to a 3. By default * # the idle time is set to zero. * 'TIME' => 1000*time() # Same as IDLE except it takes a unix timestamp in * # milliseconds. * 'RETRYCOUNT' => 0 # Set the retry counter to zero. By default XCLAIM * # doesn't modify the counter. * 'FORCE' # Creates the pending message entry even if IDs are * # not already * # in the PEL with another client. * 'JUSTID' # Return only an array of IDs rather than the messages * # themselves. * ]; * ``` * * @return Redis|array|bool An array of claimed messages or false on failure. * * @example * $redis->xGroup('CREATE', 'ships', 'combatants', '0-0', true); * * $redis->xAdd('ships', '1424-74205', ['name' => 'Defiant']); * * // Consume the ['name' => 'Defiant'] message * $msgs = $redis->xReadGroup('combatants', "Jem'Hadar", ['ships' => '>'], 1); * * // The "Jem'Hadar" consumer has the message presently * $pending = $redis->xPending('ships', 'combatants'); * var_dump($pending); * * assert($pending && isset($pending[1])); * * // Claim the message by ID. * $claimed = $redis->xClaim('ships', 'combatants', 'Sisko', 0, [$pending[1]], ['JUSTID']); * var_dump($claimed); * * // Now the 'Sisko' consumer owns the message * $pending = $redis->xPending('ships', 'combatants'); * var_dump($pending); */ public function xclaim(string $key, string $group, string $consumer, int $min_idle, array $ids, array $options): Redis|array|bool; /** * Remove one or more specific IDs from a stream. * * @param string $key The stream to modify. * @param array $ids One or more message IDs to remove. * * @return Redis|int|false The number of messages removed or false on failure. * * @see https://redis.io/docs/latest/commands/xdel/ * * @example $redis->xDel('stream', ['1-1', '2-1', '3-1']); */ public function xdel(string $key, array $ids): Redis|int|false; /** * Remove one or more IDs from a stream with extended options. * * @param string $key The stream to modify. * @param array $ids One or more message IDs to remove. * @param string|null $mode An optional mode argument. Valid modes * are as follows: KEEPREF | DELREF | ACKED * * @return Redis|array|false An array corresponding to IDs. 1 if the id was * deleted and 0 if not. * * @see https://redis.io/docs/latest/commands/xdelex/ * * @example * $redis->xadd('s', '*', ['field' => 'value1']); * $redis->xdelex('s', ['1-0'], 'KEEPREF'); */ public function xdelex(string $key, array $ids, ?string $mode = null): Redis|array|false; /** * XGROUP * * Perform various operation on consumer groups for a particular Redis STREAM. What the command does * is primarily based on which operation is passed. * * @see https://redis.io/docs/latest/commands/xgroup/ * * @param string $operation The subcommand you intend to execute. Valid options are as follows * 'HELP' - Redis will return information about the command * Requires: none * 'CREATE' - Create a consumer group. * Requires: Key, group, consumer. * 'SETID' - Set the ID of an existing consumer group for the stream. * Requires: Key, group, id. * 'CREATECONSUMER' - Create a new consumer group for the stream. You must * also pass key, group, and the consumer name you wish to * create. * Requires: Key, group, consumer. * 'DELCONSUMER' - Delete a consumer from group attached to the stream. * Requires: Key, group, consumer. * 'DESTROY' - Delete a consumer group from a stream. * Requires: Key, group. * @param string|null $key The STREAM we're operating on. * @param string|null $group The consumer group we want to create/modify/delete. * @param string|null $id_or_consumer The STREAM id (e.g. '$') or consumer group. See the operation section * for information about which to send. * @param bool $mkstream This flag may be sent in combination with the 'CREATE' operation, and * cause Redis to also create the STREAM if it doesn't currently exist. * @param int $entries_read Allows you to set Redis' 'entries-read' STREAM value. This argument is * only relevant to the 'CREATE' and 'SETID' operations. * Note: Requires Redis >= 7.0.0. * * @return mixed This command return various results depending on the operation performed. * * @example * $redis->xgroup('CREATE', 'mystream', 'workers', '$'); * */ public function xgroup(string $operation, ?string $key = null, ?string $group = null, ?string $id_or_consumer = null, bool $mkstream = false, int $entries_read = -2): mixed; /** * Retrieve information about a stream key. * * @param string $operation The specific info operation to perform. * @param string|null $arg1 The first argument (depends on operation) * @param string|null $arg2 The second argument * @param int $count The COUNT argument to `XINFO STREAM` * * @return mixed This command can return different things depending on the operation being called. * * @see https://redis.io/docs/latest/commands/xinfo/ * * @example $redis->xInfo('CONSUMERS', 'stream'); * @example $redis->xInfo('GROUPS', 'stream'); * @example $redis->xInfo('STREAM', 'stream'); */ public function xinfo(string $operation, ?string $arg1 = null, ?string $arg2 = null, int $count = -1): mixed; /** * Get the number of messages in a Redis STREAM key. * * @param string $key The Stream to check. * * @return Redis|int|false The number of messages or false on failure. * * @see https://redis.io/docs/latest/commands/xlen/ * * @example $redis->xLen('stream'); */ public function xlen(string $key): Redis|int|false; /** * Interact with stream messages that have been consumed by a consumer group but not yet * acknowledged with XACK. * * @see https://redis.io/docs/latest/commands/xpending/ * @see https://redis.io/docs/latest/commands/xreadgroup/ * * @param string $key The stream to inspect. * @param string $group The user group we want to see pending messages from. * @param string|null $start The minimum ID to consider. * @param string|null $end The maximum ID to consider. * @param int $count Optional maximum number of messages to return. * @param string|null $consumer If provided, limit the returned messages to a specific consumer. * * @return Redis|array|false The pending messages belonging to the stream or false on failure. * * @example * $redis->xpending('mystream', 'workers', '-', '+', 10); * */ public function xpending(string $key, string $group, ?string $start = null, ?string $end = null, int $count = -1, ?string $consumer = null): Redis|array|false; /** * Get a range of entries from a STREAM key. * * @param string $key The stream key name to list. * @param string $start The minimum ID to return. * @param string $end The maximum ID to return. * @param int $count An optional maximum number of entries to return. * * @return Redis|array|bool The entries in the stream within the requested range or false on failure. * * @see https://redis.io/docs/latest/commands/xrange/ * * @example $redis->xRange('stream', '0-1', '0-2'); * @example $redis->xRange('stream', '-', '+'); */ public function xrange(string $key, string $start, string $end, int $count = -1): Redis|array|bool; /** * Consume one or more unconsumed elements in one or more streams. * * @param array $streams An associative array with stream name keys and minimum id values. * @param int $count An optional limit to how many entries are returned *per stream* * @param int $block An optional maximum number of milliseconds to block the caller if no * data is available on any of the provided streams. * * @return Redis|array|bool An array of read elements or false if there aren't any. * * @see https://redis.io/docs/latest/commands/xread/ * * @example * $redis->xAdd('s03', '3-1', ['title' => 'The Search, Part I']); * $redis->xAdd('s03', '3-2', ['title' => 'The Search, Part II']); * $redis->xAdd('s03', '3-3', ['title' => 'The House Of Quark']); * $redis->xAdd('s04', '4-1', ['title' => 'The Way of the Warrior']); * $redis->xAdd('s04', '4-3', ['title' => 'The Visitor']); * $redis->xAdd('s04', '4-4', ['title' => 'Hippocratic Oath']); * * $redis->xRead(['s03' => '3-2', 's04' => '4-1']); */ public function xread(array $streams, int $count = -1, int $block = -1): Redis|array|bool; /** * Read one or more messages using a consumer group. * * @param string $group The consumer group to use. * @param string $consumer The consumer to use. * @param array $streams An array of stream names and message IDs * @param int $count Optional maximum number of messages to return * @param int $block How long to block if there are no messages available. * * @return Redis|array|bool Zero or more unread messages or false on failure. * * @see https://redis.io/docs/latest/commands/xreadgroup/ * * @example * $redis->xGroup('CREATE', 'episodes', 'ds9', '0-0', true); * * $redis->xAdd('episodes', '1-1', ['title' => 'Emissary: Part 1']); * $redis->xAdd('episodes', '1-2', ['title' => 'A Man Alone']); * * $messages = $redis->xReadGroup('ds9', 'sisko', ['episodes' => '>']); * * // After having read the two messages, add another * $redis->xAdd('episodes', '1-3', ['title' => 'Emissary: Part 2']); * * // Acknowledge the first two read messages * foreach ($messages as $stream => $stream_messages) { * $ids = array_keys($stream_messages); * $redis->xAck('stream', 'ds9', $ids); * } * * // We can now pick up where we left off, and will only get the final message * $msgs = $redis->xReadGroup('ds9', 'sisko', ['episodes' => '>']); */ public function xreadgroup(string $group, string $consumer, array $streams, int $count = 1, int $block = 1): Redis|array|bool; /** * Get a range of entries from a STREAM key in reverse chronological order. * * @param string $key The stream key to query. * @param string $end The maximum message ID to include. * @param string $start The minimum message ID to include. * @param int $count An optional maximum number of messages to include. * * @return Redis|array|bool The entries within the requested range, from newest to oldest. * * @see https://redis.io/docs/latest/commands/xrevrange/ * @see https://redis.io/docs/latest/commands/xrange/ * * @example $redis->xRevRange('stream', '0-2', '0-1'); * @example $redis->xRevRange('stream', '+', '-'); */ public function xrevrange(string $key, string $end, string $start, int $count = -1): Redis|array|bool; /** * Add to a vector set * * @param string $key The vector set to add to. * @param array $values A non-empty array of floating point values * @param mixed $element The element to add to the vector set. * @param array|null $options An optional options array * * @return Redis|int|false One if the key was added zero if not. * * @see https://redis.io/docs/latest/commands/vadd/ * * @example * $redis->vadd('embeddings', [0.12, 0.04, 0.88], 'doc:1'); * */ public function vadd(string $key, array $values, mixed $element, array|null $options = null): Redis|int|false; /** * Query similarity of a vector by element or scores * * @param string $key The vector set to query. * @param mixed $member Either an element or array of scores. PhpRedis * will attempt to infer which it is, but since * there can be some ambiguity here due to * serialization you can also explicitly specify * `ELE`, `VALUES`, or `FP32` in the options * array. * @param array|null $options An optional options array * * @return Redis|array|false An array of elements and their similarity scores, or false on failure. * * @see https://redis.io/docs/latest/commands/vsim/ * * @example * $redis->vsim('embeddings', 'doc:1', ['COUNT' => 3]); * */ public function vsim(string $key, mixed $member, array|null $options = null): Redis|array|false; /** * Get the length of a vector set * * @param string $key The vector set to query. * * @return Redis|int|false The number of elements in the vector set or false on failure. * * @see https://redis.io/docs/latest/commands/vcard/ * * @example * $redis->vcard('embeddings'); * */ public function vcard(string $key): Redis|int|false; /** * Get the dimensions of a vector set * * @param string $key The vector set to query. * * @return Redis|int|false The number of dimensions in the vector set or false on failure. * * @see https://redis.io/docs/latest/commands/vdim/ * * @example * $redis->vdim('embeddings'); * */ public function vdim(string $key): Redis|int|false; /** * Get various bits of information about a vector set * * @param string $key The vector set to query. * * @return Redis|array|false An array of information about the vector set or false on failure. * * @see https://redis.io/docs/latest/commands/vinfo/ * * @example * $redis->vinfo('embeddings'); * */ public function vinfo(string $key): Redis|array|false; /** * Check if an element is a member of a vectorset * * @param string $key The vector set to query. * @param mixed $member The member to check for. * * @return Redis|bool true if the member exists, false if it does not. * * @see https://redis.io/docs/latest/commands/vismember/ * * @example * $redis->vismember('embeddings', 'doc:1'); * */ public function vismember(string $key, mixed $member): Redis|bool; /** * Get the embeddings for a specific member * * @param string $key The vector set to query. * @param mixed $member The member to query. * @param bool $raw If set to `true`, the raw embeddings will be returned * * @return Redis|array|false An array of embeddings for the member or false on failure. * * @see https://redis.io/docs/latest/commands/vemb/ * * @example * $redis->vemb('embeddings', 'doc:1'); * */ public function vemb(string $key, mixed $member, bool $raw = false): Redis|array|false; /** * Get one or more random members from a vector set * * @param string $key The vector set to query. * @param int $count The number of random members to return. * * @see https://redis.io/docs/latest/commands/vrandmember/ * * @example * $redis->vrandmember('embeddings', 2); * */ public function vrandmember(string $key, int $count = 0): Redis|array|string|false; /** * Retreive a lexographical range of elements from a vector set * * @param string $key The vector set to query. * @param string $min The minimum element to return. * @param string $max The maximum element to return. * @param int $count An optional maximum number of elements to return. * * @return Redis|array|false An array of elements in the requested range or false on failure. * * @see https://redis.io/docs/latest/commands/vrange/ * * @example * $redis->vrange('embeddings', '-', '+', 5); * */ public function vrange(string $key, string $min, string $max, int $count = -1): Redis|array|false; /** * Remove an element from a vector set * * @param string $key The vector set to remove from. * @param mixed $member The member to remove. * * @return Redis|int|faslse 1 if the member was removed, 0 if it was not. * * @see https://redis.io/docs/latest/commands/vrem/ * * @example * $redis->vrem('embeddings', 'doc:1'); * */ public function vrem(string $key, mixed $member): Redis|int|false; /** * Set the attributes of a vector set element * * @param string $key The vector set to modify. * @param mixed $member The member to modify. * @param array|string $attributes The attributes to set. This should either * be a json encoded string or an array which * will be json encoded. * * @return Redis|int|false 1 if the attributes were set, 0 if they were not. * * @see https://redis.io/docs/latest/commands/vsetattr/ * * @example * $redis->vsetattr('embeddings', 'doc:1', ['topic' => 'tech']); * */ public function vsetattr(string $key, mixed $member, array|string $attributes): Redis|int|false; /** * Get the attributes of a vector set element * * @param string $key The vector set to query. * @param mixed $member The member to query. * @param bool $decode Whether to automatically deserialize any returned json. * * @return Redis|array|string|false An array of attributes for the member or false on failure. * * @see https://redis.io/docs/latest/commands/vgetattr/ * * @example * $redis->vgetattr('embeddings', 'doc:1'); * */ public function vgetattr(string $key, mixed $member, bool $decode = true): Redis|array|string|false; /** * Get any adajcent values for a member of a vector set. * * @param string $key The vector set to query. * @param mixed $member The member to query. * @param bool $withscores If set to `true`, the scores of the adjacent values will be returned. * * @return Redis|array|false An array of adjacent values and their scores, or false on failure. * * @see https://redis.io/docs/latest/commands/vlinks/ * * @example * $redis->vlinks('embeddings', 'doc:1', true); * */ public function vlinks(string $key, mixed $member, bool $withscores = false): Redis|array|false; /** * Get rate limiting information * * @param string $key * @param int $maxBurst * @param int $requestsPerPeriod * @param int $period * @param int $numRequests = 0 * @return Redis|array|false * * @see https://redis.io/docs/latest/commands/gcra/ * * @example * $redis->gcra('user:123', 10, 100, 3600); */ public function gcra(string $key, int $maxBurst, int $requestsPerPeriod, int $period, int $numRequests = 0): Redis|array|false; /** * Truncate a STREAM key in various ways. * * @param string $key The STREAM key to trim. * @param string $threshold This can either be a maximum length, or a minimum id. * MAXLEN - An integer describing the maximum desired length of the stream after the command. * MINID - An ID that will become the new minimum ID in the stream, as Redis will trim all * messages older than this ID. * @param bool $approx Whether redis is allowed to do an approximate trimming of the stream. This is * more efficient for Redis given how streams are stored internally. * @param bool $minid When set to `true`, users should pass a minimum ID to the `$threshold` argument. * @param int $limit An optional upper bound on how many entries to trim during the command. * * @return Redis|int|false The number of entries deleted from the stream. * * @see https://redis.io/docs/latest/commands/xtrim/ * * @example $redis->xTrim('stream', 3); * @example $redis->xTrim('stream', '2-1', false, true); */ public function xtrim(string $key, string $threshold, bool $approx = false, bool $minid = false, int $limit = -1): Redis|int|false; /** * Add one or more elements and scores to a Redis sorted set. * * @param string $key The sorted set in question. * @param array|float $score_or_options Either the score for the first element, or an array of options. * ```php * $options = [ * 'NX', # Only update elements that already exist * 'NX', # Only add new elements but don't update existing ones. * * 'LT' # Only update existing elements if the new score is * # less than the existing one. * 'GT' # Only update existing elements if the new score is * # greater than the existing one. * * 'CH' # Instead of returning the number of elements added, * # Redis will return the number Of elements that were * # changed in the operation. * * 'INCR' # Instead of setting each element to the provide score, * # increment the element by the * # provided score, much like ZINCRBY. When this option * # is passed, you may only send a single score and member. * ]; * ``` * Note: 'GX', 'LT', and 'NX' cannot be passed together, and PhpRedis * will send whichever one is last in the options array. * @param mixed ...$more_scores_and_mems A variadic number of additional scores and members. * * @return Redis|int|float|false The return value varies depending on the options passed. * * Following is information about the options that may be passed as the second argument: * * @see https://redis.io/docs/latest/commands/zadd/ * * @example * $redis->zadd('zs', 1, 'first', 2, 'second', 3, 'third'); * $redis->zAdd('zs', ['XX'], 8, 'second', 99, 'new-element'); */ public function zAdd(string $key, array|float $score_or_options, mixed ...$more_scores_and_mems): Redis|int|float|false; /** * Return the number of elements in a sorted set. * * @param string $key The sorted set to retrieve cardinality from. * * @return Redis|int|false The number of elements in the set or false on failure * * @see https://redis.io/docs/latest/commands/zcard/ * * @example $redis->zCard('zs'); */ public function zCard(string $key): Redis|int|false; /** * Count the number of members in a sorted set with scores inside a provided range. * * @param string $key The sorted set to check. * @param int|string $start The minimum score to include in the count * @param int|string $end The maximum score to include in the count * * NOTE: In addition to a floating point score you may pass the special values of '-inf' and * '+inf' meaning negative and positive infinity, respectively. * * @see https://redis.io/docs/latest/commands/zcount/ * * @example * $redis->zCount('fruit-rankings', '0', '+inf'); * $redis->zCount('fruit-rankings', 50, 60); * $redis->zCount('fruit-rankings', '-inf', 0); */ public function zCount(string $key, int|string $start, int|string $end): Redis|int|false; /** * Create or increment the score of a member in a Redis sorted set * * @param string $key The sorted set in question. * @param float $value How much to increment the score. * * @return Redis|float|false The new score of the member or false on failure. * * @see https://redis.io/docs/latest/commands/zincrby/ * * @example * $redis->zIncrBy('zs', 5.0, 'bananas'); * $redis->zIncrBy('zs', 2.0, 'eggplants'); */ public function zIncrBy(string $key, float $value, mixed $member): Redis|float|false; /** * Count the number of elements in a sorted set whose members fall within the provided * lexographical range. * * @param string $key The sorted set to check. * @param string $min The minimum matching lexographical string * @param string $max The maximum matching lexographical string * * @return Redis|int|false The number of members that fall within the range or false on failure. * * @see https://redis.io/docs/latest/commands/zlexcount/ * * @example * $redis->zAdd('captains', 0, 'Janeway', 0, 'Kirk', 0, 'Picard', 0, 'Sisko', 0, 'Archer'); * $redis->zLexCount('captains', '[A', '[S'); */ public function zLexCount(string $key, string $min, string $max): Redis|int|false; /** * Retrieve the score of one or more members in a sorted set. * * @see https://redis.io/docs/latest/commands/zmscore/ * * @param string $key The sorted set * @param mixed $member The first member to return the score from * @param mixed ...$other_members One or more additional members to return the scores of. * * @return Redis|array|false An array of the scores of the requested elements. * * @example * $redis->zAdd('zs', 0, 'zero', 1, 'one', 2, 'two', 3, 'three'); * * $redis->zMScore('zs', 'zero', 'two'); * $redis->zMScore('zs', 'one', 'not-a-member'); */ public function zMscore(string $key, mixed $member, mixed ...$other_members): Redis|array|false; /** * Pop one or more of the highest scoring elements from a sorted set. * * @param string $key The sorted set to pop elements from. * @param int|null $count An optional count of elements to pop. * * @return Redis|array|false All of the popped elements with scores or false on failure * * @see https://redis.io/docs/latest/commands/zpopmax/ * * @example * $redis->zAdd('zs', 0, 'zero', 1, 'one', 2, 'two', 3, 'three'); * * $redis->zPopMax('zs'); * $redis->zPopMax('zs', 2);. */ public function zPopMax(string $key, ?int $count = null): Redis|array|false; /** * Pop one or more of the lowest scoring elements from a sorted set. * * @param string $key The sorted set to pop elements from. * @param int|null $count An optional count of elements to pop. * * @return Redis|array|false The popped elements with their scores or false on failure. * * @see https://redis.io/docs/latest/commands/zpopmin/ * * @example * $redis->zAdd('zs', 0, 'zero', 1, 'one', 2, 'two', 3, 'three'); * * $redis->zPopMin('zs'); * $redis->zPopMin('zs', 2); */ public function zPopMin(string $key, ?int $count = null): Redis|array|false; /** * Retrieve a range of elements of a sorted set between a start and end point. * How the command works in particular is greatly affected by the options that * are passed in. * * @param string $key The sorted set in question. * @param mixed $start The starting index we want to return. * @param mixed $end The final index we want to return. * * @param array|bool|null $options This value may either be an array of options to pass to * the command, or for historical purposes a boolean which * controls just the 'WITHSCORES' option. * ```php * $options = [ * 'WITHSCORES' => true, # Return both scores and members. * 'LIMIT' => [10, 10], # Start at offset 10 and return 10 elements. * 'REV' # Return the elements in reverse order * 'BYSCORE', # Treat `start` and `end` as scores instead * 'BYLEX' # Treat `start` and `end` as lexicographical values. * ]; * ``` * * Note: `BYLEX` and `BYSCORE` are mutually exclusive. * * * @return Redis|array|false An array with matching elements or false on failure. * * @see https://redis.io/docs/latest/commands/zrange/ * @category zset * * @example * $redis->zRange('zset', 0, -1); * $redis->zRange('zset', '-inf', 'inf', ['byscore']); */ public function zRange(string $key, string|int $start, string|int $end, array|bool|null $options = null): Redis|array|false; /** * Retrieve a range of elements from a sorted set by legographical range. * * @param string $key The sorted set to retrieve elements from * @param string $min The minimum legographical value to return * @param string $max The maximum legographical value to return * @param int $offset An optional offset within the matching values to return * @param int $count An optional count to limit the replies to (used in conjunction with offset) * * @return Redis|array|false An array of matching elements or false on failure. * * @see https://redis.io/docs/latest/commands/zrangebylex/ * * @example * $redis = new Redis(['host' => 'localhost']); * $redis->zAdd('captains', 0, 'Janeway', 0, 'Kirk', 0, 'Picard', 0, 'Sisko', 0, 'Archer'); * * $redis->zRangeByLex('captains', '[A', '[S'); * $redis->zRangeByLex('captains', '[A', '[S', 2, 2); */ public function zRangeByLex(string $key, string $min, string $max, int $offset = -1, int $count = -1): Redis|array|false; /** * Retrieve a range of members from a sorted set by their score. * * @param string $key The sorted set to query. * @param string $start The minimum score of elements that Redis should return. * @param string $end The maximum score of elements that Redis should return. * @param array $options Options that change how Redis will execute the command. * * OPTION TYPE MEANING * 'WITHSCORES' bool Whether to also return scores. * 'LIMIT' [offset, count] Limit the reply to a subset of elements. * * @return Redis|array|false The number of matching elements or false on failure. * * @see https://redis.io/docs/latest/commands/zrangebyscore/ * * @example * $redis->zRangeByScore('zs', 20, 30, ['WITHSCORES' => true]); * $redis->zRangeByScore('zs', 20, 30, ['WITHSCORES' => true, 'LIMIT' => [5, 5]]); */ public function zRangeByScore(string $key, string $start, string $end, array $options = []): Redis|array|false; /** * This command is similar to ZRANGE except that instead of returning the values directly * it will store them in a destination key provided by the user * * @param string $dstkey The key to store the resulting element(s) * @param string $srckey The source key with element(s) to retrieve * @param string $start The starting index to store * @param string $end The ending index to store * @param array|bool|null $options Our options array that controls how the command will function. * * @return Redis|int|false The number of elements stored in $dstkey or false on failure. * * @see https://redis.io/docs/latest/commands/zrange/ * @see Redis::zRange * @category zset * * See {@link Redis::zRange} for a full description of the possible options. * * @example * $redis->zrangestore('recent:leaders', 'leaders', '0', '9'); * */ public function zrangestore(string $dstkey, string $srckey, string $start, string $end, array|bool|null $options = null): Redis|int|false; /** * Retrieve one or more random members from a Redis sorted set. * * @param string $key The sorted set to pull random members from. * @param array|null $options One or more options that determine exactly how the command operates. * OPTION TYPE MEANING * 'COUNT' int The number of random members to return. * 'WITHSCORES' bool Whether to return scores and members instead of * * @return Redis|string|array One or more random elements. * * @see https://redis.io/docs/latest/commands/zrandmember/ * * @example * $redis->zRandMember('zs', ['COUNT' => 2, 'WITHSCORES' => true]); */ public function zRandMember(string $key, ?array $options = null): Redis|string|array; /** * Get the rank of a member of a sorted set, by score. * * @param string $key The sorted set to check. * @param mixed $member The member to test. * * @return Redis|int|false The rank of the requested member. * @see https://redis.io/docs/latest/commands/zrank/ * * @example * $redis->zRank('zs', 'zero'); * $redis->zRank('zs', 'three'); */ public function zRank(string $key, mixed $member): Redis|int|false; /** * Remove one or more members from a Redis sorted set. * * @param mixed $key The sorted set in question. * @param mixed $member The first member to remove. * @param mixed ...$other_members One or more members to remove passed in a variadic fashion. * * @return Redis|int|false The number of members that were actually removed or false on failure. * * @see https://redis.io/docs/latest/commands/zrem/ * * @example * $redis->zRem('zs', 'mem:0', 'mem:1', 'mem:2', 'mem:6', 'mem:7', 'mem:8', 'mem:9'); */ public function zRem(mixed $key, mixed $member, mixed ...$other_members): Redis|int|false; /** * Remove zero or more elements from a Redis sorted set by legographical range. * * @param string $key The sorted set to remove elements from. * @param string $min The start of the lexographical range to remove. * @param string $max The end of the lexographical range to remove * * @return Redis|int|false The number of elements removed from the set or false on failure. * * @see https://redis.io/docs/latest/commands/zremrangebylex/ * @see Redis::zrangebylex() * * @example * $redis->zRemRangeByLex('zs', '[a', '(b'); * $redis->zRemRangeByLex('zs', '(banana', '(eggplant'); */ public function zRemRangeByLex(string $key, string $min, string $max): Redis|int|false; /** * Remove one or more members of a sorted set by their rank. * * @param string $key The sorted set where we want to remove members. * @param int $start The rank when we want to start removing members * @param int $end The rank we want to stop removing membersk. * * @return Redis|int|false The number of members removed from the set or false on failure. * * @see https://redis.io/docs/latest/commands/zremrangebyrank/ * * @example * $redis->zRemRangeByRank('zs', 0, 3); */ public function zRemRangeByRank(string $key, int $start, int $end): Redis|int|false; /** * Remove one or more members of a sorted set by their score. * * @param string $key The sorted set where we want to remove members. * @param string $start The lowest score to remove. * @param string $end The highest score to remove. * * @return Redis|int|false The number of members removed from the set or false on failure. * * @see https://redis.io/docs/latest/commands/zremrangebyrank/ * * @example * $redis->zAdd('zs', 2, 'two', 4, 'four', 6, 'six'); * $redis->zRemRangeByScore('zs', 2, 4); */ public function zRemRangeByScore(string $key, string $start, string $end): Redis|int|false; /** * List the members of a Redis sorted set in reverse order * * @param string $key The sorted set in question. * @param int $start The index to start listing elements * @param int $end The index to stop listing elements. * @param mixed|null $scores Whether or not Redis should also return each members score. See * the example below demonstrating how it may be used. * * @return Redis|array|false The members (and possibly scores) of the matching elements or false * on failure. * * @see https://redis.io/docs/latest/commands/zrevrange/ * * @example * $redis->zRevRange('zs', 0, -1); * $redis->zRevRange('zs', 2, 3); * $redis->zRevRange('zs', 0, -1, true); * $redis->zRevRange('zs', 0, -1, ['withscores' => true]); */ public function zRevRange(string $key, int $start, int $end, mixed $scores = null): Redis|array|false; /** * List members of a Redis sorted set within a legographical range, in reverse order. * * @param string $key The sorted set to list * @param string $max The maximum legographical element to include in the result. * @param string $min The minimum lexographical element to include in the result. * @param int $offset An option offset within the matching elements to start at. * @param int $count An optional count to limit the replies to. * * @return Redis|array|false The matching members or false on failure. * * @see https://redis.io/docs/latest/commands/zrevrangebylex/ * @see Redis::zrangebylex() * * @example * $redis->zRevRangeByLex('captains', '[Q', '[J'); * $redis->zRevRangeByLex('captains', '[Q', '[J', 1, 2); */ public function zRevRangeByLex(string $key, string $max, string $min, int $offset = -1, int $count = -1): Redis|array|false; /** * List elements from a Redis sorted set by score, highest to lowest * * @param string $key The sorted set to query. * @param string $max The highest score to include in the results. * @param string $min The lowest score to include in the results. * @param array|bool $options An options array that modifies how the command executes. * * ```php * $options = [ * 'WITHSCORES' => true|false # Whether or not to return scores * 'LIMIT' => [offset, count] # Return a subset of the matching members * ]; * ``` * * NOTE: For legacy reason, you may also simply pass `true` for the * options argument, to mean `WITHSCORES`. * * @return Redis|array|false The matching members in reverse order of score or false on failure. * * @see https://redis.io/docs/latest/commands/zrevrangebyscore/ * * @example * $redis->zadd('oldest-people', 122.4493, 'Jeanne Calment', 119.2932, 'Kane Tanaka', * 119.2658, 'Sarah Knauss', 118.7205, 'Lucile Randon', * 117.7123, 'Nabi Tajima', 117.6301, 'Marie-Louise Meilleur', * 117.5178, 'Violet Brown', 117.3753, 'Emma Morano', * 117.2219, 'Chiyo Miyako', 117.0740, 'Misao Okawa'); * * $redis->zRevRangeByScore('oldest-people', 122, 119); * $redis->zRevRangeByScore('oldest-people', 'inf', 118); * $redis->zRevRangeByScore('oldest-people', '117.5', '-inf', ['LIMIT' => [0, 1]]); */ public function zRevRangeByScore(string $key, string $max, string $min, array|bool $options = []): Redis|array|false; /** * Retrieve a member of a sorted set by reverse rank. * * @param string $key The sorted set to query. * @param mixed $member The member to look up. * * @return Redis|int|false The reverse rank (the rank if counted high to low) of the member or * false on failure. * @see https://redis.io/docs/latest/commands/zrevrank/ * * @example * $redis->zAdd('ds9-characters', 10, 'Sisko', 9, 'Garak', 8, 'Dax', 7, 'Odo'); * * $redis->zrevrank('ds9-characters', 'Sisko'); * $redis->zrevrank('ds9-characters', 'Garak'); */ public function zRevRank(string $key, mixed $member): Redis|int|false; /** * Get the score of a member of a sorted set. * * @param string $key The sorted set to query. * @param mixed $member The member we wish to query. * * @return Redis|float|false The score of the requested element or false if it is not found. * * @see https://redis.io/docs/latest/commands/zscore/ * * @example * $redis->zAdd('telescopes', 11.9, 'LBT', 10.4, 'GTC', 10, 'HET'); * $redis->zScore('telescopes', 'LBT'); */ public function zScore(string $key, mixed $member): Redis|float|false; /** * Given one or more sorted set key names, return every element that is in the first * set but not any of the others. * * @param array $keys One or more sorted sets. * @param array|null $options An array which can contain ['WITHSCORES' => true] if you want Redis to * return members and scores. * * @return Redis|array|false An array of members or false on failure. * * @see https://redis.io/docs/latest/commands/zdiff/ * * @example * $redis->zAdd('primes', 1, 'one', 3, 'three', 5, 'five'); * $redis->zAdd('evens', 2, 'two', 4, 'four'); * $redis->zAdd('mod3', 3, 'three', 6, 'six'); * * $redis->zDiff(['primes', 'evens', 'mod3']); */ public function zdiff(array $keys, ?array $options = null): Redis|array|false; /** * Store the difference of one or more sorted sets in a destination sorted set. * * See {@link Redis::zdiff} for a more detailed description of how the diff operation works. * * @param string $dst The destination set name. * @param array $keys One or more source key names * * @return Redis|int|false The number of elements stored in the destination set or false on * failure. * * @see https://redis.io/docs/latest/commands/zdiff/ * @see Redis::zdiff() * * @example * $redis->zdiffstore('only:new', ['all:users', 'inactive:users']); * */ public function zdiffstore(string $dst, array $keys): Redis|int|false; /** * Compute the intersection of one or more sorted sets and return the members * * @param array $keys One or more sorted sets. * @param array|null $weights An optional array of weights to be applied to each set when performing * the intersection. * @param array|null $options Options for how Redis should combine duplicate elements when performing the * intersection. See Redis::zunion() for details. * * @return Redis|array|false All of the members that exist in every set. * * @see https://redis.io/docs/latest/commands/zinter/ * * @example * $redis->zAdd('TNG', 2, 'Worf', 2.5, 'Data', 4.0, 'Picard'); * $redis->zAdd('DS9', 2.5, 'Worf', 3.0, 'Kira', 4.0, 'Sisko'); * * $redis->zInter(['TNG', 'DS9']); * $redis->zInter(['TNG', 'DS9'], NULL, ['withscores' => true]); * $redis->zInter(['TNG', 'DS9'], NULL, ['withscores' => true, 'aggregate' => 'max']); */ public function zinter(array $keys, ?array $weights = null, ?array $options = null): Redis|array|false; /** * Similar to ZINTER but instead of returning the intersected values, this command returns the * cardinality of the intersected set. * * @see https://redis.io/docs/latest/commands/zintercard/ * @see https://redis.io/docs/latest/commands/zinter/ * @see Redis::zinter() * * @param array $keys One or more sorted set key names. * @param int $limit An optional upper bound on the returned cardinality. If set to a value * greater than zero, Redis will stop processing the intersection once the * resulting cardinality reaches this limit. * * @return Redis|int|false The cardinality of the intersection or false on failure. * * @example * $redis->zAdd('zs1', 1, 'one', 2, 'two', 3, 'three', 4, 'four'); * $redis->zAdd('zs2', 2, 'two', 4, 'four'); * * $redis->zInterCard(['zs1', 'zs2']); */ public function zintercard(array $keys, int $limit = -1): Redis|int|false; /** * Compute the intersection of one or more sorted sets storing the result in a new sorted set. * * @param string $dst The destination sorted set to store the intersected values. * @param array $keys One or more sorted set key names. * @param array|null $weights An optional array of floats to weight each passed input set. * @param string|null $aggregate An optional aggregation method to use. * 'SUM' - Store sum of all intersected members (this is the default). * 'MIN' - Store minimum value for each intersected member. * 'MAX' - Store maximum value for each intersected member. * * @return Redis|int|false The total number of members writtern to the destination set or false on failure. * * @see https://redis.io/docs/latest/commands/zinterstore/ * @see https://redis.io/docs/latest/commands/zinter/ * * @example * $redis->zAdd('zs1', 3, 'apples', 2, 'pears'); * $redis->zAdd('zs2', 4, 'pears', 3, 'bananas'); * $redis->zAdd('zs3', 2, 'figs', 3, 'pears'); * * $redis->zInterStore('fruit-sum', ['zs1', 'zs2', 'zs3']); * $redis->zInterStore('fruit-max', ['zs1', 'zs2', 'zs3'], NULL, 'MAX'); */ public function zinterstore(string $dst, array $keys, ?array $weights = null, ?string $aggregate = null): Redis|int|false; /** * Scan the members of a sorted set incrementally, using a cursor * * @param string $key The sorted set to scan. * @param int|string|null $iterator A reference to an iterator that should be initialized to NULL initially, that * will be updated after each subsequent call to ZSCAN. Once the iterator * has returned to zero the scan is complete * @param string|null $pattern An optional glob-style pattern that limits which members are returned during * the scanning process. * @param int $count A hint for Redis that tells it how many elements it should test before returning * from the call. The higher the more work Redis may do in any one given call to * ZSCAN potentially blocking for longer periods of time. * * @return Redis|array|false An array of elements or false on failure. * * @see https://redis.io/docs/latest/commands/zscan/ * @see https://redis.io/docs/latest/commands/scan/ * @see Redis::scan() * * NOTE: See Redis::scan() for detailed example code on how to call SCAN like commands. * * @example * $it = null; * while ($members = $redis->zscan('leaders', $it)) { * foreach ($members as $member => $score) { * printf('%s => %s' . PHP_EOL, $member, $score); * } * } * */ public function zscan(string $key, null|int|string &$iterator, ?string $pattern = null, int $count = 0): Redis|array|false; /** * Retrieve the union of one or more sorted sets * * @param array $keys One or more sorted set key names * @param array|null $weights An optional array with floating point weights used when performing the union. * Note that if this argument is passed, it must contain the same number of * elements as the $keys array. * @param array|null $options An array that modifies how this command functions. * * ```php * $options = [ * # By default when members exist in more than one set Redis will SUM * # total score for each match. Instead, it can return the AVG, MIN, * # or MAX value based on this option. * 'AGGREGATE' => 'sum' | 'min' | 'max' * * # Whether Redis should also return each members aggregated score. * 'WITHSCORES' => true | false * ] * ``` * * @return Redis|array|false The union of each sorted set or false on failure * * @see https://redis.io/docs/latest/commands/zunion/ * * @example * $redis->del('store1', 'store2', 'store3'); * $redis->zAdd('store1', 1, 'apples', 3, 'pears', 6, 'bananas'); * $redis->zAdd('store2', 3, 'apples', 5, 'coconuts', 2, 'bananas'); * $redis->zAdd('store3', 2, 'bananas', 6, 'apples', 4, 'figs'); * * $redis->zUnion(['store1', 'store2', 'store3'], NULL, ['withscores' => true]); * $redis->zUnion(['store1', 'store3'], [2, .5], ['withscores' => true]); * $redis->zUnion(['store1', 'store3'], [2, .5], ['withscores' => true, 'aggregate' => 'MIN']); */ public function zunion(array $keys, ?array $weights = null, ?array $options = null): Redis|array|false; /** * Perform a union on one or more Redis sets and store the result in a destination sorted set. * * @param string $dst The destination set to store the union. * @param array $keys One or more input keys on which to perform our union. * @param array|null $weights An optional weights array used to weight each input set. * @param string|null $aggregate An optional modifier in how Redis will combine duplicate members. * Valid: 'MIN', 'MAX', 'SUM'. * * @return Redis|int|false The number of members stored in the destination set or false on failure. * * @see https://redis.io/docs/latest/commands/zunionstore/ * @see Redis::zunion() * * @example * $redis->zAdd('zs1', 1, 'one', 3, 'three'); * $redis->zAdd('zs1', 2, 'two', 4, 'four'); * $redis->zadd('zs3', 1, 'one', 7, 'five'); * * $redis->zUnionStore('dst', ['zs1', 'zs2', 'zs3']); */ public function zunionstore(string $dst, array $keys, ?array $weights = null, ?string $aggregate = null): Redis|int|false; /** * Ask the server for the XXH3 digest of a given key's value * * @param strinig $key The key to retrieve the digest for. * @return Redis|string|false The XXH3 digest as a string or false on failure. * * @see https://redis.io/docs/latest/commands/digest/ * * @example * $redis->digest('session:42'); * */ public function digest(string $key): Redis|string|false; } class RedisException extends RuntimeException {}