Collection paired FASTQ files:
  class: Collection
  collection_type: list
  elements:
  - class: File
    identifier: todo_element_name
    path: todo_test_data_path.ext
Compute Cufflinks FPKM: todo_param_value
Compute StringTie FPKM: todo_param_value
GTF file of annotation:
  class: File
  path: todo_test_data_path.ext
Generate additional QC reports: todo_param_value
Reference genome: todo_param_value
Strandedness: todo_param_value
Use featureCounts for generating count tables: todo_param_value

# type: collection, collection_type: list:paired, doc: Should be a list of paired-end RNA-seq fastqs
Collection paired FASTQ files:
  class: Collection
  collection_type: list:paired
  elements:
  - class: Collection
    type: paired
    identifier: todo_element_name
    elements:
    - class: File
      identifier: forward
      path: todo_test_data_path_forward.ext
    - class: File
      identifier: reverse
      path: todo_test_data_path_reverse.ext
# type: string, doc: This is optional. Fastp will use overlapping. If you want to specify, for Nextera use: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC, for TruSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, optional: true
Forward adapter: todo_param_value
# type: string, doc: This is optional. Fastp will use overlapping. If you want to specify, for Nextera use: CTGTCTCTTATACACATCTGACGCTGCCGACGA, for TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT, optional: true
Reverse adapter: todo_param_value
# type: boolean, doc: Whether to compute additional QC like fastQC, gene body coverage etc...
Generate additional QC reports: false
# type: string, doc: Select the reference genome
Reference genome: todo_param_value
# type: data, doc: GTF compatible with the reference genome. Mind the UCSC/Ensembl differences in chromosome naming.
GTF file of annotation:
  class: File
  path: todo_test_data_path.ext
# type: string, doc: For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence
Strandedness: todo_param_value
# type: boolean, doc: Use featureCounts tool instead of RNA STAR?
Use featureCounts for generating count tables: false
# type: boolean, doc: Whether FPKM values should be computed with Cufflinks
Compute Cufflinks FPKM: false
# type: data, doc: It could be a GTF with for example one entry for the chrM forward and one entry for the chrM reverse, optional: true
GTF with regions to exclude from FPKM normalization with Cufflinks:
  class: File
  path: todo_test_data_path.ext
# type: boolean, doc: Whether FPKM values should be computed with StringTie
Compute StringTie FPKM: false