More tutorial testing, tutorial updates.

jmchilton · jmchilton · commit 016b92348097 · 2018-05-24T13:34:34.000-04:00
diff --git a/docs/_writing_dependencies_containers_cwl.rst b/docs/_writing_dependencies_containers_cwl.rst
@@ -53,6 +53,8 @@ to check if a tool contains only best-practice ``requirement`` tags. The ``lint`
 command can also be fed the ``--biocontainers`` flag to check if a
 BioContainers_ container has been registered that is compatible with that tool.
 
+.. include:: _writing_containers_linter_explain.rst
+
 The Conda exercises project template has an example tool (``exercise3``) that we
 can use to demonstrate ``--biocontainers``. If you are continuing from the Conda
 tutorial, simply move to ``../exercise3`` otherwise using ``planemo project_init``
@@ -79,8 +81,6 @@ to grab the exercise as show below.
     .. INFO: BioContainer best-practice container found [quay.io/biocontainers/seqtk:1.2--1].
     Failed linting
 
-.. include:: _writing_containers_linter_explain.rst
-
 ::
 
     $ planemo test --biocontainers seqtk_seq.cwl
diff --git a/docs/tests/tests_conda_cwl.sh b/docs/tests/tests_conda_cwl.sh
@@ -1,15 +1,13 @@
 #!/bin/bash
 
-SCRIPTS_DIRECTORY="$( cd "$( dirname "${BASH_SOURCE[0]}" )" && pwd )"
-PROJECT_DIRECTORY="${SCRIPTS_DIRECTORY}/../.."
-
 set -o xtrace
 
 set -e
 
 shopt -s expand_aliases  # Needed for conda_env test
 
 # Preconditions:
+# - seqtk not on PATH
 # - seqtk_example doesn't exist and in home directory
 # - conda_exercises doesn't exist in home directory.
 # - seqtk environment is absent
@@ -24,8 +22,7 @@ conda remove --force --yes --name '__seqtk@1.2' --all || true
 
 echo "Setup completed seqtk example"
 # TODO: project_init once in master branch
-# planemo project_init --template=seqtk_complete_cwl seqtk_example
-cp -r $PROJECT_DIRECTORY/project_templates/seqtk_complete_cwl seqtk_example
+planemo project_init --template=seqtk_complete_cwl seqtk_example
 cd seqtk_example
 
 echo "Check conda_requirements - should see them linting properly"
@@ -52,8 +49,7 @@ planemo test --no-container seqtk_seq.cwl
 cd
 
 # TODO: project_init once in master branch
-# planemo project_init --template conda_exercises_cwl conda_exercises
-cp -r $PROJECT_DIRECTORY/project_templates/conda_exercises_cwl conda_exercises
+planemo project_init --template conda_exercises_cwl conda_exercises
 cd conda_exercises/exercise_1
 
 ls
diff --git a/docs/tests/tests_docker_cwl.sh b/docs/tests/tests_docker_cwl.sh
@@ -1,37 +1,47 @@
 #!/bin/bash
 
-SCRIPTS_DIRECTORY="$( cd "$( dirname "${BASH_SOURCE[0]}" )" && pwd )"
-PROJECT_DIRECTORY="${SCRIPTS_DIRECTORY}/../.."
-
 set -o xtrace
 
 set -e
 
 # Preconditions
+# - seqtk not on PATH
 # - Planemo installed
-# - seqtk_example directory doesn't exist in the home directory.
+# - conda_exercises directory doesn't exist in the home directory. 
+# - conda_answers directory doesn't exist in the home directory.
 # - conda_testing directory doesn't exist in the home directory
 # - docker running and sudo-less access available via the docker command.
 
 cd
 rm -rf conda_exercises
+rm -rf conda_answers_cwl
 rm -rf conda_testing
 
-
 echo "Setup completed seqtk example"
-# TODO: project_init once in master branch
-# planemo project_init --template=conda_exercies_cwl conda_exercies
-cp -r $PROJECT_DIRECTORY/project_templates/conda_exercies_cwl conda_exercies
+planemo project_init --template=conda_exercies_cwl conda_exercies
 cd conda_exercies
 
+cd conda_exercises/exercise_3
+
 echo "We should see biocontainer found for this tool, but not a Docker container"
 planemo lint --biocontainers seqtk_seq.cwl | true
 
 echo "This should pass and we should see container was used."
-planemo test --biocontainers --engine cwltool seqtk_seq.cwl
+planemo test --biocontainers seqtk_seq.cwl
+
+echo "This should fail without biocontainers"
+planemo test seqtk_seq.cwl
 
 cd ..
 
+echo "Run seqtk exercise answers"
+planemo project_init --template=conda_answers_cwl conda_answers
+cd conda_answers/exercise_3
+
+planemo lint --biocontainers seqtk_seq.cwl
+planemo test seqtk_seq.cwl
+
+
 planemo project_init --template=conda_testing_cwl conda_testing
 cd conda_testing/
 echo "Should show quay.io/biocontainers/mulled-v2-fe8faa35dbf6dc65a0f7f5d4ea12e31a79f73e40:03dc1d2818d9de56938078b8b78b82d967c1f820-0 is built"
diff --git a/project_templates/conda_answers_cwl/exercise_3/seqtk_seq.cwl b/project_templates/conda_answers_cwl/exercise_3/seqtk_seq.cwl
@@ -0,0 +1,94 @@
+#!/usr/bin/env cwl-runner
+cwlVersion: 'v1.0'
+class: CommandLineTool
+id: "seqtk_seq"
+label: "Convert to FASTA (seqtk)"
+hints:
+  DockerRequirement:
+    dockerPull: quay.io/biocontainers/seqtk:1.2--1
+  SoftwareRequirement:
+    packages:
+    - package: seqtk
+      version:
+      - "1.2"
+inputs:
+  input1:
+    type: File
+    doc: |
+      Input FASTA file.
+    inputBinding:
+      position: 1
+      prefix: "-a"
+outputs:
+  output1:
+    type: File
+    outputBinding:
+      glob: out
+baseCommand:
+  - "seqtk"
+  - "seq"
+arguments: []
+stdout: out
+doc: |
+  
+  Usage:   seqtk seq [options] <in.fq>|<in.fa>
+
+  Options: -q INT    mask bases with quality lower than INT [0]
+           -X INT    mask bases with quality higher than INT [255]
+           -n CHAR   masked bases converted to CHAR; 0 for lowercase [0]
+           -l INT    number of residues per line; 0 for 2^32-1 [0]
+           -Q INT    quality shift: ASCII-INT gives base quality [33]
+           -s INT    random seed (effective with -f) [11]
+           -f FLOAT  sample FLOAT fraction of sequences [1]
+           -M FILE   mask regions in BED or name list FILE [null]
+           -L INT    drop sequences with length shorter than INT [0]
+           -c        mask complement region (effective with -M)
+           -r        reverse complement
+           -A        force FASTA output (discard quality)
+           -C        drop comments at the header lines
+           -N        drop sequences containing ambiguous bases
+           -1        output the 2n-1 reads only
+           -2        output the 2n reads only
+           -V        shift quality by '(-Q) - 33'
+           -U        convert all bases to uppercases
+           -S        strip of white spaces in sequences
+
+$namespaces:
+  s: http://schema.org/
+$schemas:
+- http://schema.org/docs/schema_org_rdfa.html
+
+s:mainEntity:
+  class: s:SoftwareSourceCode
+  s:name: seqtk
+  s:about: 'Toolkit for processing sequences in FASTA/Q formats'
+  s:url: https://github.com/lh3/seqtk
+  s:codeRepository: https://github.com/lh3/seqtk
+
+  s:license:
+  - https://opensource.org/licenses/MIT
+
+  s:targetProduct:
+    class: s:SoftwareApplication
+    s:softwareVersion: "1.2"
+    s:applicationCategory: commandline tool
+  s:programmingLanguage: C
+  s:publication:
+  - class: s:ScholarlyArticle
+    id: http://dx.doi.org/10.1093/bioinformatics/bts635
+
+  s:author:
+  - class: s:Person
+    s:name: "Heng Li"
+    s:sameAs:
+    - id: https://orcid.org/0000-0003-4874-2874
+
+s:downloadUrl: https://github.com/galaxyproject/planemo/blob/master/project_templates/seqtk_complete_cwl/seqtk_seq.cwl
+s:codeRepository: https://github.com/galaxyproject/planemo
+
+s:author:
+  class: s:Person
+  s:name: John Chilton
+  s:email: mailto:jmchilton@gmail.com
+  s:sameAs:
+  - id: https://orcid.org/0000-0002-6794-0756
diff --git a/project_templates/conda_answers_cwl/exercise_3/seqtk_seq_job.yml b/project_templates/conda_answers_cwl/exercise_3/seqtk_seq_job.yml
@@ -0,0 +1,4 @@
+
+input1:
+  class: File
+  path: test-data/2.fastq
diff --git a/project_templates/conda_answers_cwl/exercise_3/seqtk_seq_tests.yml b/project_templates/conda_answers_cwl/exercise_3/seqtk_seq_tests.yml
@@ -0,0 +1,6 @@
+
+- doc: test generated from example command
+  job: seqtk_seq_job.json
+  outputs:
+    output1:
+      path: test-data/2.fasta
diff --git a/project_templates/conda_answers_cwl/exercise_3/test-data/2.fasta b/project_templates/conda_answers_cwl/exercise_3/test-data/2.fasta
@@ -0,0 +1,6 @@
+>EAS54_6_R1_2_1_413_324
+CCCTTCTTGTCTTCAGCGTTTCTCC
+>EAS54_6_R1_2_1_540_792
+TTGGCAGGCCAAGGCCGATGGATCA
+>EAS54_6_R1_2_1_443_348
+GTTGCTTCTGGCGTGGGTGGGGGGG
diff --git a/project_templates/conda_answers_cwl/exercise_3/test-data/2.fastq b/project_templates/conda_answers_cwl/exercise_3/test-data/2.fastq
@@ -0,0 +1,12 @@
+@EAS54_6_R1_2_1_413_324
+CCCTTCTTGTCTTCAGCGTTTCTCC
++
+;;3;;;;;;;;;;;;7;;;;;;;88
+@EAS54_6_R1_2_1_540_792
+TTGGCAGGCCAAGGCCGATGGATCA
++
+;;;;;;;;;;;7;;;;;-;;;3;83
+@EAS54_6_R1_2_1_443_348
+GTTGCTTCTGGCGTGGGTGGGGGGG
++EAS54_6_R1_2_1_443_348
+;;;;;;;;;;;9;7;;.7;393333
diff --git a/project_templates/conda_exercises_cwl/exercise_3/seqtk_seq_job.yml b/project_templates/conda_exercises_cwl/exercise_3/seqtk_seq_job.yml
@@ -0,0 +1,4 @@
+
+input1:
+  class: File
+  path: test-data/2.fastq
diff --git a/project_templates/conda_exercises_cwl/exercise_3/seqtk_seq_tests.yml b/project_templates/conda_exercises_cwl/exercise_3/seqtk_seq_tests.yml
@@ -1,9 +1,6 @@
 
 - doc: test generated from example command
-  job:
-    input1:
-      class: File
-      path: test-data/2.fastq
+  job: seqtk_seq_job.json
   outputs:
     output1:
       path: test-data/2.fasta
diff --git a/scripts/run_doc_test.sh b/scripts/run_doc_test.sh
@@ -0,0 +1,28 @@
+#!/bin/bash
+
+# Usage: DOC_TEST_RUNNER="https://raw.githubusercontent.com/galaxyproject/planemo/master/scripts/run_doc_test.sh"
+#        DOCS=building bash <(curl -s "$DOC_TEST_RUNNER")
+#        DOCS=conda bash <(curl -s "$DOC_TEST_RUNNER")
+#        DOCS=conda_cwl bash <(curl -s "$DOC_TEST_RUNNER")
+
+set -e
+
+: ${PLANEMO_TARGET:="."}
+: ${PLANEMO_VIRTUAL_ENV:=".venv-doc-tests"}
+: ${DOCS:="building"}
+
+# Ensure Planemo is installed.
+if [ ! -d "${PLANEMO_VIRTUAL_ENV}" ]; then
+    virtualenv "${PLANEMO_VIRTUAL_ENV}"
+    . "${PLANEMO_VIRTUAL_ENV}"/bin/activate
+    pip install -U pip>7
+    # Intentionally expand wildcards in PLANEMO_TARGET.
+    shopt -s extglob
+    pip install ${PLANEMO_TARGET}
+fi
+. "${PLANEMO_VIRTUAL_ENV}"/bin/activate
+
+planemo conda_init | true
+export PATH="$HOME/miniconda3/bin:$PATH"
+
+bash docs/tests/tests_"${DOCS}".sh
diff --git a/scripts/run_galaxy_workflow_tests.sh b/scripts/run_galaxy_workflow_tests.sh
@@ -1,5 +1,7 @@
 #!/bin/bash
 
+# Usage: http://planemo.readthedocs.io/en/latest/test_format.html#galaxy-testing-template
+
 : ${PLANEMO_TARGET:="planemo==0.52.0"}
 : ${PLANEMO_OPTIONS:=""}  # e.g. PLANEMO_OPTIONS="--verbose"
 : ${PLANEMO_PROFILE_NAME:="wxflowtest"}
@@ -8,19 +10,20 @@
 : ${PLANEMO_TEST_STYLE:="serve_and_test"}  # profile_serve_and_test, serve_and_test, docker_serve_and_test, test, docker_test, docker_test_path_paste
 : ${PLANEMO_SERVE_DATABASE_TYPE:="postgres"}  # used if not using Docker with PLANEMO_TEST_STYLE
 : ${PLANEMO_DOCKER_GALAXY_IMAGE:="quay.io/bgruening/galaxy:18.01"}  # used if used Docker with PLANEMO_TEST_STYLE
+: ${PLANEMO_VIRTUAL_ENV:=".venv"}
 
 GALAXY_URL="http://localhost:$PLANEMO_SERVE_PORT"
 
 # Ensure Planemo is installed.
-if [ ! -d .venv ]; then
-    virtualenv .venv
-    . .venv/bin/activate
-    pip install -U pip
+if [ ! -d "${PLANEMO_VIRTUAL_ENV}" ]; then
+    virtualenv "${PLANEMO_VIRTUAL_ENV}"
+    . "${PLANEMO_VIRTUAL_ENV}"/bin/activate
+    pip install -U pip>7
     # Intentionally expand wildcards in PLANEMO_TARGET.
     shopt -s extglob
     pip install ${PLANEMO_TARGET}
 fi
-. .venv/bin/activate
+. "${PLANEMO_VIRTUAL_ENV}"/bin/activate
 
 # Run test.
 # This example shows off a bunch of different ways one could test with Planemo,

-Original file line number
+Diff line change
@@ @@ -0,0 +1,4 @@ @@
++
 +input1:
 +  class: File
 +  path: test-data/2.fastq