Updating workflows/epigenetics/atacseq from 0.9 to 0.10 by gxydevbot · Pull Request #276 · galaxyproject/iwc

gxydevbot · 2023-11-10T11:24:34Z

Hello! This is an automated update of the following workflow: workflows/epigenetics/atacseq. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4 should be updated to toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicatesWithMateCigar/2.18.2.3

The workflow release number has been updated from 0.9 to 0.10.

workflows/epigenetics/atacseq/CHANGELOG.md

github-actions · 2024-03-14T12:18:01Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ atacseq.ga_0

Problems:

Output with path /tmp/tmpcvar0dh4/mapping stats__effcccaf-2c9f-46e2-a991-eeb349576927 different than expected
Expected text '32872 (11.70%) aligned concordantly 0 times' in output ('280859 reads; of these:
  280859 (100.00%) were paired; of these:
    63325 (22.55%) aligned concordantly 0 times
    92695 (33.00%) aligned concordantly exactly 1 time
    124839 (44.45%) aligned concordantly >1 times
    ----
    63325 pairs aligned concordantly 0 times; of these:
      22423 (35.41%) aligned discordantly 1 time
    ----
    40902 pairs aligned 0 times concordantly or discordantly; of these:
      81804 mates make up the pairs; of these:
        20792 (25.42%) aligned 0 times
        16976 (20.75%) aligned exactly 1 time
        44036 (53.83%) aligned >1 times
96.30% overall alignment rate
')

Output with path /tmp/tmpg46z1ng4/BAM filtered rmDup__ad709c8c-8efa-4177-bc89-cfffafb4cf93 different than expected
Expected file size of 14134105+-1000000 found 12297725

Output with path /tmp/tmp9dufh6fe/MACS2 narrowPeak__accce04d-d400-4016-84e2-c2091bd2ccc6 different than expected
Expected 225+-0 lines in the output found 164

Output with path /tmp/tmpd4h9_lyq/MACS2 report__2f76034b-7764-4d13-ba67-ef2a267af997 different than expected
Expected text '# tag size is determined as 47 bps' in output ('# This file is generated by MACS version 2.2.9.1
# Command line: callpeak -t /tmp/tmp54uix5l3/files/b/b/f/dataset_bbfcf8c1-2427-4950-90ae-16c4f29b3340.dat --name SRR891268_chr22_enriched --format BED --gsize 2700000000 --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
# ARGUMENTS LIST:
# name = SRR891268_chr22_enriched
# format = BED
# ChIP-seq file = ['/tmp/tmp54uix5l3/files/b/b/f/dataset_bbfcf8c1-2427-4950-90ae-16c4f29b3340.dat']
# control file = None
# effective genome size = 2.70e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
# tag size is determined as 49 bps
# total tags in treatment: 203732
# Sequencing ends will be shifted towards 5' by 100 bp(s)
# d = 200
')

Output with path /tmp/tmp20kim_yv/Coverage from MACS2 (bigwig)__533c9d55-600d-4c82-9473-a711c3a4d8d9 different than expected
Expected file size of 2594908+-200000 found 2279659

Output with path /tmp/tmpi5zpahcy/Summits +-500bp (merged)__b540adf4-aeb1-4e77-a060-d9a18548f85b different than expected
Expected 213+-0 lines in the output found 157

Output with path /tmp/tmpzitbiwcq/Nb of reads in summits +-500bp__f1393e0d-49d7-4095-a90b-0dc140a44a21 different than expected
Expected line '8802' in output ('6057
')

Output with path /tmp/tmpvv0znvg9/bigwig normalized per million reads in peaks__1200b8df-9ea2-46ba-a1d8-52619a1bad9c different than expected
Expected file size of 1133795+-100000 found 1031113

Output with path /tmp/tmpctlkb6ev/bowtie2__1cb07282-d69b-4c13-b2af-86e04cc9317c different than expected
Expected line 'SRR891268_chr22_enriched	280964	280964	32872	108014	140078	13586	6283	7890	24399	98.88	12199.5	3141.5	3945.0' in output ('Sample	total_reads	paired_total	paired_aligned_none	paired_aligned_one	paired_aligned_multi	paired_aligned_discord_one	paired_aligned_mate_none	paired_aligned_mate_one	paired_aligned_mate_multi	overall_alignment_rate	paired_aligned_mate_multi_halved	paired_aligned_mate_none_halved	paired_aligned_mate_one_halved
SRR891268_chr22_enriched	280859	280859	63325	92695	124839	22423	20792	16976	44036	96.3	22018.0	10396.0	8488.0
')

Workflow invocation details

Invocation Messages

Steps

Step 1: PE fastq input:
- step_state: scheduled
Step 2: reference_genome:
- step_state: scheduled

Step 11: convert BAM to BED to improve peak calling:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp54uix5l3/files/a/d/7/dataset_ad709c8c-8efa-4177-bc89-cfffafb4cf93.dat' ./input.bam &&  bedtools bamtobed    -i ./input.bam > '/tmp/tmp54uix5l3/job_working_directory/000/9/outputs/dataset_bbfcf8c1-2427-4950-90ae-16c4f29b3340.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
ed_score	`false`
option	`""`
split	`false`
tag	`""`

Step 12: Compute fragment length histogram:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp54uix5l3/files/a/d/7/dataset_ad709c8c-8efa-4177-bc89-cfffafb4cf93.dat' localbam.bam && ln -f -s '/tmp/tmp54uix5l3/files/_metadata_files/f/4/4/metadata_f448b126-c564-4d8f-985e-e925c0b5fdb6.dat' localbam.bam.bai && java -jar '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/pe_histogram/bd1416eea1f0/pe_histogram/PEHistogram.jar' -B localbam.bam -I localbam.bam.bai -u 500 -p '/tmp/tmp54uix5l3/job_working_directory/000/10/outputs/dataset_fed4a992-c91b-40cf-94c0-826a977cce06.dat' -t '/tmp/tmp54uix5l3/job_working_directory/000/10/outputs/dataset_31e1f240-dfeb-4088-8d5e-8071634d77b0.dat' 1>/dev/null

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
lower_limit	`None`
upper_limit	`"500"`

Step 13: number of reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp54uix5l3/files/a/d/7/dataset_ad709c8c-8efa-4177-bc89-cfffafb4cf93.dat' infile && ln -s '/tmp/tmp54uix5l3/files/_metadata_files/f/4/4/metadata_f448b126-c564-4d8f-985e-e925c0b5fdb6.dat' infile.bai &&        samtools view -@ $addthreads -c     -o outfile     infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
mode	`{"__current_case__": 0, "output_options": {"__current_case__": 1, "reads_report_type": "count"}, "outtype": "all_reads"}`

Step 14: Call Peak with MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmp54uix5l3/files/b/b/f/dataset_bbfcf8c1-2427-4950-90ae-16c4f29b3340.dat'  --name SRR891268_chr22_enriched    --format BED   --gsize '2700000000'           --call-summits  --keep-dup 'all'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '-100'  2>&1 > macs2_stderr) && cp SRR891268_chr22_enriched_peaks.xls '/tmp/tmp54uix5l3/job_working_directory/000/12/outputs/dataset_ca0044af-fce3-4a56-89c0-f91eed6dc478.dat'   && ( count=`ls -1 SRR891268_chr22_enriched* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmp54uix5l3/job_working_directory/000/12/outputs/dataset_55825f2b-1064-468a-afee-7de5278fc58a_files' && cp -r SRR891268_chr22_enriched* '/tmp/tmp54uix5l3/job_working_directory/000/12/outputs/dataset_55825f2b-1064-468a-afee-7de5278fc58a_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmp54uix5l3/job_working_directory/000/12/outputs/dataset_55825f2b-1064-468a-afee-7de5278fc58a_files' macs2_stderr > '/tmp/tmp54uix5l3/job_working_directory/000/12/outputs/dataset_55825f2b-1064-468a-afee-7de5278fc58a.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

Exit Code:

```
0
```

Standard Output:

INFO  @ Thu, 14 Mar 2024 12:09:00: 
# Command line: callpeak -t /tmp/tmp54uix5l3/files/b/b/f/dataset_bbfcf8c1-2427-4950-90ae-16c4f29b3340.dat --name SRR891268_chr22_enriched --format BED --gsize 2700000000 --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
# ARGUMENTS LIST:
# name = SRR891268_chr22_enriched
# format = BED
# ChIP-seq file = ['/tmp/tmp54uix5l3/files/b/b/f/dataset_bbfcf8c1-2427-4950-90ae-16c4f29b3340.dat']
# control file = None
# effective genome size = 2.70e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
 
INFO  @ Thu, 14 Mar 2024 12:09:00: #1 read tag files... 
INFO  @ Thu, 14 Mar 2024 12:09:00: #1 read treatment tags... 
INFO  @ Thu, 14 Mar 2024 12:09:00: #1 tag size is determined as 49 bps 
INFO  @ Thu, 14 Mar 2024 12:09:00: #1 tag size = 49.0 
INFO  @ Thu, 14 Mar 2024 12:09:00: #1  total tags in treatment: 203732 
INFO  @ Thu, 14 Mar 2024 12:09:00: #1 finished! 
INFO  @ Thu, 14 Mar 2024 12:09:00: #2 Build Peak Model... 
INFO  @ Thu, 14 Mar 2024 12:09:00: #2 Skipped... 
INFO  @ Thu, 14 Mar 2024 12:09:00: #2 Use 200 as fragment length 
INFO  @ Thu, 14 Mar 2024 12:09:00: #2 Sequencing ends will be shifted towards 5' by 100 bp(s) 
INFO  @ Thu, 14 Mar 2024 12:09:00: #3 Call peaks... 
INFO  @ Thu, 14 Mar 2024 12:09:00: #3 Going to call summits inside each peak ... 
INFO  @ Thu, 14 Mar 2024 12:09:00: #3 Pre-compute pvalue-qvalue table... 
INFO  @ Thu, 14 Mar 2024 12:09:01: #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ Thu, 14 Mar 2024 12:09:01: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... SRR891268_chr22_enriched_treat_pileup.bdg 
INFO  @ Thu, 14 Mar 2024 12:09:01: #3   Write bedGraph files for control lambda (after scaling if necessary)... SRR891268_chr22_enriched_control_lambda.bdg 
INFO  @ Thu, 14 Mar 2024 12:09:01: #3   Pileup will be based on sequencing depth in treatment. 
INFO  @ Thu, 14 Mar 2024 12:09:01: #3 Call peaks for each chromosome... 
INFO  @ Thu, 14 Mar 2024 12:09:01: #4 Write output xls file... SRR891268_chr22_enriched_peaks.xls 
INFO  @ Thu, 14 Mar 2024 12:09:01: #4 Write peak in narrowPeak format file... SRR891268_chr22_enriched_peaks.narrowPeak 
INFO  @ Thu, 14 Mar 2024 12:09:01: #4 Write summits bed file... SRR891268_chr22_enriched_summits.bed 
INFO  @ Thu, 14 Mar 2024 12:09:01: Done!

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
advanced_options	`{"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 2, "keep_dup_options_selector": "all"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": false, "to_large": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
control	`{"__current_case__": 1, "c_select": "No"}`
cutoff_options	`{"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}`
dbkey	`"hg19"`
effective_genome_size_options	`{"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "2700000000"}`
format	`"BED"`
nomodel_type	`{"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "-100"}`
outputs	`["peaks_tabular", "summits", "bdg", "html"]`
treatment	`{"__current_case__": 0, "input_treatment_file": {"values": [{"id": 16, "src": "dce"}]}, "t_multi_select": "No"}`

Step 15: compute 1/million reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmp54uix5l3/job_working_directory/000/13/configs/tmpnycb6ygp' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp54uix5l3/files/e/b/d/dataset_ebdb5093-5c81-462b-a7f2-3d1b5a134f8e.dat' '/tmp/tmp54uix5l3/job_working_directory/000/13/outputs/dataset_4f76cab2-018a-4c80-93b3-861a67eb48e2.dat'

Exit Code:

```
0
```

Standard Output:

Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
avoid_scientific_notation	`true`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"}`

Step 16: Bigwig from MACS2 (no norm):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -v "^track" '/tmp/tmp54uix5l3/files/1/7/3/dataset_173176cc-a9dc-4d92-9a83-a0dd0cb2e868.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len' '/tmp/tmp54uix5l3/job_working_directory/000/14/outputs/dataset_533c9d55-600d-4c82-9473-a711c3a4d8d9.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 17: get summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools slop    -g '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len'  -i '/tmp/tmp54uix5l3/files/6/5/d/dataset_65de989d-3740-4faf-a4d7-ad8fba0b3aa1.dat' -b 500  > '/tmp/tmp54uix5l3/job_working_directory/000/15/outputs/dataset_85658df5-a757-4d65-9d4f-47d8d1018203.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
addition	`{"__current_case__": 0, "addition_select": "b", "b": "500"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
genome_file_opts	`{"__current_case__": 0, "genome": "hg19", "genome_file_opts_selector": "loc"}`
header	`false`
pct	`false`
strand	`false`

Step 18: summary of MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -P -A 0 -B 0  -i -- '^#' '/tmp/tmp54uix5l3/files/c/a/0/dataset_ca0044af-fce3-4a56-89c0-f91eed6dc478.dat' | grep -v "^--$" > '/tmp/tmp54uix5l3/job_working_directory/000/16/outputs/dataset_2f76034b-7764-4d13-ba67-ef2a267af997.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
case_sensitive	`"-i"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
color	`"NOCOLOR"`
dbkey	`"hg19"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-P"`
url_paste	`"^#"`

Step 19: Convert 1/million reads to parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
param_type	`"text"`
remove_newlines	`true`

Step 20: Isolate each bigwig do normalize not average:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
input	`{"values": [{"id": 23, "src": "hdca"}]}`
rules	{"mapping": [{"collapsible_value": {"__class__": "RuntimeValue"}, "columns": [0, 1], "connectable": true, "editing": false, "is_workflow": false, "type": "list_identifiers"}], "rules": [{"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}]}

Step 3: effective_genome_size:
- step_state: scheduled

Step 21: Merge summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mergeBed -i '/tmp/tmp54uix5l3/files/8/5/6/dataset_85658df5-a757-4d65-9d4f-47d8d1018203.dat'  -d 0    > '/tmp/tmp54uix5l3/job_working_directory/000/18/outputs/dataset_b540adf4-aeb1-4e77-a060-d9a18548f85b.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
c_and_o_argument_repeat	`[]`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
distance	`"0"`
header	`false`
strand	`""`

Step 22: normalize by million reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmp54uix5l3/files/5/3/3/dataset_533c9d55-600d-4c82-9473-a711c3a4d8d9.dat --outFileName '/tmp/tmp54uix5l3/job_working_directory/000/27/outputs/dataset_a9fdfbb2-e812-4c32-906c-abba1726d565.dat' --outFileFormat 'bigwig'     --scaleFactors '4.908409086446901' --binSize 1000

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
advancedOpt	`{"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "4.908409086446901", "showAdvancedOpt": "yes", "skipNAs": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
outFileFormat	`"bigwig"`
region	`""`

Step 23: Compute coverage on summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools coverage        -a '/tmp/tmp54uix5l3/files/b/5/4/dataset_b540adf4-aeb1-4e77-a060-d9a18548f85b.dat' -b '/tmp/tmp54uix5l3/files/a/d/7/dataset_ad709c8c-8efa-4177-bc89-cfffafb4cf93.dat'      | sort -k1,1 -k2,2n > '/tmp/tmp54uix5l3/job_working_directory/000/19/outputs/dataset_f8cde28b-993f-4f02-8d46-a92f72c9c4a7.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
a_or_b	`false`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
d	`false`
dbkey	`"hg19"`
hist	`false`
mean	`false`
overlap_a	`None`
overlap_b	`None`
reciprocal_overlap	`false`
reduce_or_iterate	`{"__current_case__": 0, "inputB": {"values": [{"id": 14, "src": "dce"}]}, "reduce_or_iterate_selector": "iterate"}`
sorted	`false`
split	`false`
strandedness	`false`

Step 24: number of reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp54uix5l3/job_working_directory/000/20/configs/tmp17xkws_v' '/tmp/tmp54uix5l3/files/f/8/c/dataset_f8cde28b-993f-4f02-8d46-a92f72c9c4a7.dat' > '/tmp/tmp54uix5l3/job_working_directory/000/20/outputs/dataset_f1393e0d-49d7-4095-a90b-0dc140a44a21.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	`"{S=S+$4}END{print S}"`
dbkey	`"hg19"`

Step 25: compute 1/million reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmp54uix5l3/job_working_directory/000/21/configs/tmpvd2sguzc' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp54uix5l3/files/f/1/3/dataset_f1393e0d-49d7-4095-a90b-0dc140a44a21.dat' '/tmp/tmp54uix5l3/job_working_directory/000/21/outputs/dataset_9b05e9a9-aa1e-4072-afa6-08cea36b2c1f.dat'

Exit Code:

```
0
```

Standard Output:

Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
avoid_scientific_notation	`true`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"}`

Step 26: Combine number of reads in peaks with total number of reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmp54uix5l3/galaxy-dev/tools/filters/catWrapper.py '/tmp/tmp54uix5l3/job_working_directory/000/22/outputs/dataset_22b8526f-e316-4861-956d-00325e4fb4cf.dat' '/tmp/tmp54uix5l3/files/f/1/3/dataset_f1393e0d-49d7-4095-a90b-0dc140a44a21.dat' '/tmp/tmp54uix5l3/files/e/b/d/dataset_ebdb5093-5c81-462b-a7f2-3d1b5a134f8e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
queries	`[{"__index__": 0, "input2": {"values": [{"id": 19, "src": "dce"}]}}]`

Step 27: Convert 1/million reads in peaks to parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
param_type	`"text"`
remove_newlines	`true`

Step 28: reads in peaks multiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp54uix5l3/job_working_directory/000/24/configs/tmpwpgo636a' '/tmp/tmp54uix5l3/files/2/2/b/dataset_22b8526f-e316-4861-956d-00325e4fb4cf.dat' > '/tmp/tmp54uix5l3/job_working_directory/000/24/outputs/dataset_74fae802-3b19-4c23-a32f-d5af944c12e5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	`" NR==1{print \"in peaks\",$1;inp=$1}NR==2{print \"outside peaks\",$1 - inp}"`
dbkey	`"hg19"`

Step 29: normalize by million reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmp54uix5l3/files/5/3/3/dataset_533c9d55-600d-4c82-9473-a711c3a4d8d9.dat --outFileName '/tmp/tmp54uix5l3/job_working_directory/000/28/outputs/dataset_1200b8df-9ea2-46ba-a1d8-52619a1bad9c.dat' --outFileFormat 'bigwig'     --scaleFactors '165.0982334489021' --binSize 1000

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
advancedOpt	`{"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "165.0982334489021", "showAdvancedOpt": "yes", "skipNAs": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
outFileFormat	`"bigwig"`
region	`""`

Step 30: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&    ln -s '/tmp/tmp54uix5l3/files/7/f/e/dataset_7febd112-3bab-4f1a-8378-bf93e35fdd69.dat' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" && mkdir multiqc_WDir/bowtie2_1 &&        grep -q '% overall alignment rate' /tmp/tmp54uix5l3/files/e/f/f/dataset_effcccaf-2c9f-46e2-a991-eeb349576927.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmp54uix5l3/files/e/f/f/dataset_effcccaf-2c9f-46e2-a991-eeb349576927.dat' 'multiqc_WDir/bowtie2_1/SRR891268_chr22_enriched'  &&   mkdir multiqc_WDir/custom_content_2 && ln -s '/tmp/tmp54uix5l3/files/7/7/1/dataset_77199701-2e8e-4a9d-83ff-ffe32ddf0024.dat' 'multiqc_WDir/custom_content_2/file_2_0' && more /tmp/tmp54uix5l3/files/7/7/1/dataset_77199701-2e8e-4a9d-83ff-ffe32ddf0024.dat && mkdir multiqc_WDir/picard_3 &&      mkdir 'multiqc_WDir/picard_3/markdups_0' &&    grep -q 'MarkDuplicates' /tmp/tmp54uix5l3/files/d/d/e/dataset_ddee7e10-0e19-4cbd-b261-a6b0db131f6d.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmp54uix5l3/files/d/d/e/dataset_ddee7e10-0e19-4cbd-b261-a6b0db131f6d.dat' 'multiqc_WDir/picard_3/markdups_0/SRR891268_chr22_enriched'  &&    mkdir multiqc_WDir/custom_content_4 && ln -s '/tmp/tmp54uix5l3/files/3/1/e/dataset_31e1f240-dfeb-4088-8d5e-8071634d77b0.dat' 'multiqc_WDir/custom_content_4/file_4_0' && more /tmp/tmp54uix5l3/files/3/1/e/dataset_31e1f240-dfeb-4088-8d5e-8071634d77b0.dat && mkdir multiqc_WDir/macs2_5 &&    grep -q "# This file is generated by MACS" /tmp/tmp54uix5l3/files/c/a/0/dataset_ca0044af-fce3-4a56-89c0-f91eed6dc478.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmp54uix5l3/files/c/a/0/dataset_ca0044af-fce3-4a56-89c0-f91eed6dc478.dat' 'multiqc_WDir/macs2_5/SRR891268_chr22_enriched_peaks.xls' && mkdir multiqc_WDir/custom_content_6 && ln -s '/tmp/tmp54uix5l3/files/7/4/f/dataset_74fae802-3b19-4c23-a32f-d5af944c12e5.dat' 'multiqc_WDir/custom_content_6/file_6_0' && more /tmp/tmp54uix5l3/files/7/4/f/dataset_74fae802-3b19-4c23-a32f-d5af944c12e5.dat &&  multiqc multiqc_WDir --filename 'report'    --export  --config '/tmp/tmp54uix5l3/job_working_directory/000/25/configs/tmp40pvrcam'

Exit Code:

```
0
```

Standard Error:

  /// MultiQC 🔍 | v1.11

|           multiqc | MultiQC Version v1.21 now available!
|           multiqc | Search path : /tmp/tmp54uix5l3/job_working_directory/000/25/working/multiqc_WDir
|    custom_content | Could not parse comment file header for MultiQC custom content: file_4_0
|    custom_content | section_2: Found 1 samples (bargraph)
|    custom_content | section_4: Found 1 samples (linegraph)
|    custom_content | section_6: Found 1 samples (bargraph)
|             macs2 | Found 1 logs
|            picard | Found 1 MarkDuplicates reports
|           bowtie2 | Found 1 reports
|          cutadapt | Found 1 reports
|           multiqc | Compressing plot data
|           multiqc | Report      : report.html
|           multiqc | Data        : report_data
|           multiqc | Plots       : report_plots
|           multiqc | MultiQC complete

Standard Output:

::::::::::::::
/tmp/tmp54uix5l3/files/7/7/1/dataset_77199701-2e8e-4a9d-83ff-ffe32ddf0024.dat
::::::::::::::
chrM	210995
others	329931
::::::::::::::
/tmp/tmp54uix5l3/files/3/1/e/dataset_31e1f240-dfeb-4088-8d5e-8071634d77b0.dat
::::::::::::::
# localbam.bam
# Chromosome_ID	Chromosome_Size	Aligned_Reads
# chr10	135534747	4614.0
# chr11	135006516	5038.0
# chr11_gl000202_random	40103	0.0
# chr12	133851895	4844.0
# chr13	115169878	3430.0
# chr14	107349540	3096.0
# chr15	102531392	2234.0
# chr16	90354753	2784.0
# chr17_ctg5_hap1	1680828	0.0
# chr17	81195210	2534.0
# chr17_gl000203_random	37498	0.0
# chr17_gl000204_random	81310	0.0
# chr17_gl000205_random	174588	40.0
# chr17_gl000206_random	41001	0.0
# chr18	78077248	2694.0
# chr18_gl000207_random	4262	0.0
# chr19	59128983	2234.0
# chr19_gl000208_random	92689	2.0
# chr19_gl000209_random	159169	0.0
# chr1	249250621	8652.0
# chr1_gl000191_random	106433	2.0
# chr1_gl000192_random	547496	2.0
# chr20	63025520	2108.0
# chr21	48129895	1070.0
# chr21_gl000210_random	27682	0.0
# chr22	51304566	100362.0
# chr2	243199373	8894.0
# chr3	198022430	7554.0
# chr4_ctg9_hap1	590426	0.0
# chr4	191154276	7376.0
# chr4_gl000193_random	189789	2.0
# chr4_gl000194_random	191469	2.0
# chr5	180915260	6756.0
# chr6_apd_hap1	4622290	0.0
# chr6_cox_hap2	4795371	2.0
# chr6_dbb_hap3	4610396	0.0
# chr6	171115067	6350.0
# chr6_mann_hap4	4683263	2.0
# chr6_mcf_hap5	4833398	0.0
# chr6_qbl_hap6	4611984	0.0
# chr6_ssto_hap7	4928567	0.0
# chr7	159138663	5854.0
# chr7_gl000195_random	182896	12.0
# chr8	146364022	5616.0
# chr8_gl000196_random	38914	0.0
# chr8_gl000197_random	37175	0.0
# chr9	141213431	3930.0
# chr9_gl000198_random	90085	14.0
# chr9_gl000199_random	169874	2.0
# chr9_gl000200_random	187035	0.0
# chr9_gl000201_random	36148	0.0
# chrM	16571	0.0
# chrUn_gl000211	166566	6.0
# chrUn_gl000212	186858	2.0
# chrUn_gl000213	164239	0.0
# chrUn_gl000214	137718	10.0
# chrUn_gl000215	172545	0.0
# chrUn_gl000216	172294	2.0
# chrUn_gl000217	172149	16.0
# chrUn_gl000218	161147	0.0
# chrUn_gl000219	179198	10.0
# chrUn_gl000220	161802	208.0
# chrUn_gl000221	155397	2.0
# chrUn_gl000222	186861	0.0
# chrUn_gl000223	180455	0.0
# chrUn_gl000224	179693	8.0
# chrUn_gl000225	211173	4.0
# chrUn_gl000226	15008	6.0
# chrUn_gl000227	128374	0.0
# chrUn_gl000228	129120	0.0
# chrUn_gl000229	19913	70.0
# chrUn_gl000230	43691	8.0
# chrUn_gl000231	27386	76.0
# chrUn_gl000232	40652	130.0
# chrUn_gl000233	45941	26.0
# chrUn_gl000234	40531	118.0
# chrUn_gl000235	34474	48.0
# chrUn_gl000236	41934	0.0
# chrUn_gl000237	45867	56.0
# chrUn_gl000238	39939	2.0
# chrUn_gl000239	33824	2.0
# chrUn_gl000240	41933	10.0
# chrUn_gl000241	42152	110.0
# chrUn_gl000242	43523	8.0
# chrUn_gl000243	43341	12.0
# chrUn_gl000244	39929	0.0
# chrUn_gl000245	36651	2.0
# chrUn_gl000246	38154	4.0
# chrUn_gl000247	36422	0.0
# chrUn_gl000248	39786	4.0
# chrUn_gl000249	38502	0.0
# chrX	155270560	4662.0
# chrY	59373566	4.0
# Total Genome Size: 3.137161264E9	Total Aligned Tags: 203732.0
# bowtie2	# 2.5.3
# "/usr/local/bin/bowtie2-align-s --wrapper basic-0 -p 1 -x /cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full --very-sensitive -1 input_f.fastq -2 input_r.fastq"
# MarkDuplicates	# Version:3.1.1
# MarkDuplicates --TAGGING_POLICY All --INPUT SRR891268_chr22_enriched --OUTPUT /tmp/tmp54uix5l3/job_working_directory/000/7/outputs/dataset_ad709c8c-8efa-4177-bc89-cfffafb4cf93.dat --METRICS_FILE /tmp/tmp54uix5l3/job_working_directory/000/7/outputs/dataset_ddee7e10-0e19-4cbd-b261-a6b0db131f6d.dat --REMOVE_DUPLICATES true --ASSUME_SORTED true --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --VERBOSITY ERROR --QUIET true --VALIDATION_STRINGENCY LENIENT --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX <optimized capture of last three ':' separated fields as numeric values> --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false
# Average Insert Size: 179.82926589833704
# Median Insert Size: 155.0
# Std deviation of Insert Size: 116.053138392536
# Number of ReadPairs: 101866.0
# Histogram
# Size (bp)	Frequency
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.0
20	0.0
21	0.0
22	0.0
23	0.0
24	0.0
25	0.0
26	4.0
27	1.0
28	2.0
29	0.0
30	1.0
31	1.0
32	0.0
33	4.0
34	6.0
35	16.0
36	8.0
37	17.0
38	14.0
39	25.0
40	30.0
41	24.0
42	37.0
43	43.0
44	26.0
45	32.0
46	52.0
47	37.0
48	13.0
49	19.0
50	1189.0
51	1450.0
52	1335.0
53	1142.0
54	1041.0
55	1022.0
56	934.0
57	778.0
58	757.0
59	711.0
60	711.0
61	880.0
62	925.0
63	834.0
64	905.0
65	885.0
66	766.0
67	696.0
68	652.0
69	598.0
70	637.0
71	717.0
72	749.0
73	772.0
74	737.0
75	678.0
76	651.0
77	578.0
78	569.0
79	530.0
80	509.0
81	594.0
82	631.0
83	584.0
84	603.0
85	579.0
86	593.0
87	545.0
88	487.0
89	439.0
90	395.0
91	419.0
92	470.0
93	512.0
94	484.0
95	501.0
96	473.0
97	431.0
98	380.0
99	350.0
100	350.0
101	380.0
102	342.0
103	371.0
104	420.0
105	411.0
106	414.0
107	364.0
108	363.0
109	301.0
110	281.0
111	315.0
112	306.0
113	335.0
114	330.0
115	321.0
116	329.0
117	352.0
118	293.0
119	276.0
120	261.0
121	261.0
122	254.0
123	266.0
124	250.0
125	264.0
126	294.0
127	265.0
128	256.0
129	260.0
130	250.0
131	234.0
132	209.0
133	245.0
134	253.0
135	238.0
136	272.0
137	304.0
138	288.0
139	287.0
140	248.0
141	238.0
142	225.0
143	193.0
144	221.0
145	219.0
146	226.0
147	265.0
148	238.0
149	240.0
150	268.0
151	267.0
152	255.0
153	258.0
154	212.0
155	221.0
156	229.0
157	249.0
158	256.0
159	267.0
160	228.0
161	239.0
162	255.0
163	221.0
164	232.0
165	300.0
166	330.0
167	387.0
168	371.0
169	345.0
170	287.0
171	299.0
172	251.0
173	251.0
174	303.0
175	353.0
176	372.0
177	383.0
178	421.0
179	351.0
180	289.0
181	321.0
182	270.0
183	271.0
184	322.0
185	315.0
186	324.0
187	339.0
188	348.0
189	334.0
190	305.0
191	309.0
192	291.0
193	303.0
194	323.0
195	374.0
196	347.0
197	344.0
198	305.0
199	318.0
200	309.0
201	314.0
202	307.0
203	340.0
204	349.0
205	336.0
206	340.0
207	342.0
208	315.0
209	287.0
210	330.0
211	340.0
212	297.0
213	318.0
214	271.0
215	320.0
216	336.0
217	324.0
218	347.0
219	297.0
220	313.0
221	285.0
222	286.0
223	270.0
224	306.0
225	307.0
226	287.0
227	283.0
228	289.0
229	256.0
230	284.0
231	275.0
232	264.0
233	250.0
234	255.0
235	239.0
236	226.0
237	237.0
238	225.0
239	232.0
240	214.0
241	221.0
242	235.0
243	211.0
244	170.0
245	202.0
246	217.0
247	214.0
248	178.0
249	158.0
250	185.0
251	175.0
252	158.0
253	181.0
254	192.0
255	174.0
256	143.0
257	140.0
258	156.0
259	159.0
260	143.0
261	125.0
262	160.0
263	126.0
264	128.0
265	132.0
266	139.0
267	109.0
268	134.0
269	110.0
270	122.0
271	114.0
272	126.0
273	96.0
274	120.0
275	119.0
276	124.0
277	119.0
278	124.0
279	96.0
280	99.0
281	124.0
282	113.0
283	121.0
284	113.0
285	79.0
286	88.0
287	89.0
288	105.0
289	105.0
290	101.0
291	82.0
292	101.0
293	104.0
294	97.0
295	102.0
296	95.0
297	102.0
298	95.0
299	98.0
300	98.0
301	109.0
302	115.0
303	96.0
304	85.0
305	75.0
306	84.0
307	94.0
308	119.0
309	81.0
310	98.0
311	94.0
312	102.0
313	94.0
314	87.0
315	93.0
316	102.0
317	77.0
318	91.0
319	104.0
320	100.0
321	92.0
322	83.0
323	76.0
324	82.0
325	106.0
326	101.0
327	92.0
328	82.0
329	86.0
330	91.0
331	98.0
332	79.0
333	79.0
334	98.0
335	79.0
336	93.0
337	92.0
338	94.0
339	88.0
340	77.0
341	95.0
342	89.0
343	112.0
344	90.0
345	119.0
346	106.0
347	108.0
348	114.0
349	78.0
350	95.0
351	95.0
352	96.0
353	99.0
354	97.0
355	118.0
356	93.0
357	101.0
358	99.0
359	90.0
360	103.0
361	102.0
362	110.0
363	119.0
364	117.0
365	105.0
366	123.0
367	115.0
368	121.0
369	123.0
370	112.0
371	121.0
372	114.0
373	94.0
374	115.0
375	113.0
376	106.0
377	112.0
378	104.0
379	113.0
380	104.0
381	105.0
382	114.0
383	109.0
384	111.0
385	108.0
386	110.0
387	113.0
388	115.0
389	128.0
390	130.0
391	112.0
392	128.0
393	95.0
394	119.0
395	111.0
396	109.0
397	111.0
398	115.0
399	104.0
400	106.0
401	113.0
402	107.0
403	118.0
404	103.0
405	93.0
406	111.0
407	113.0
408	130.0
409	106.0
410	102.0
411	97.0
412	93.0
413	112.0
414	100.0
415	96.0
416	93.0
417	89.0
418	102.0
419	96.0
420	98.0
421	108.0
422	92.0
423	95.0
424	80.0
425	76.0
426	102.0
427	90.0
428	80.0
429	82.0
430	94.0
431	93.0
432	85.0
433	77.0
434	91.0
435	90.0
436	72.0
437	78.0
438	71.0
439	66.0
440	77.0
441	80.0
442	78.0
443	68.0
444	63.0
445	71.0
446	70.0
447	77.0
448	56.0
449	61.0
450	59.0
451	60.0
452	49.0
453	59.0
454	65.0
455	73.0
456	56.0
457	50.0
458	72.0
459	52.0
460	60.0
461	67.0
462	57.0
463	61.0
464	53.0
465	50.0
466	52.0
467	58.0
468	44.0
469	64.0
470	52.0
471	57.0
472	47.0
473	63.0
474	48.0
475	53.0
476	57.0
477	41.0
478	48.0
479	50.0
480	60.0
481	46.0
482	42.0
483	51.0
484	47.0
485	35.0
486	40.0
487	41.0
488	51.0
489	44.0
490	36.0
491	37.0
492	48.0
493	52.0
494	49.0
495	52.0
496	56.0
497	50.0
498	42.0
499	49.0
500	46.0
::::::::::::::
/tmp/tmp54uix5l3/files/7/4/f/dataset_74fae802-3b19-4c23-a32f-d5af944c12e5.dat
::::::::::::::
in peaks	6057
outside peaks	197675
|         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 8/8

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
comment	`""`
dbkey	`"hg19"`
export	`true`
flat	`false`
results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 11, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "chrM", "software": "custom_content", "title": "reads mapping on chrM", "xlab": "", "ylab": ""}}, {"__index__": 3, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 9, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}, {"__index__": 4, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 14, "src": "hdca"}]}, "plot_type": "linegraph", "section_name": "Fragment size", "software": "custom_content", "title": "Fragment size distribution", "xlab": "", "ylab": ""}}, {"__index__": 5, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 16, "src": "hdca"}]}, "software": "macs2"}}, {"__index__": 6, "software_cond": {"__current_case__": 32, "description": "Number of reads falling 500bp from a summit", "input": {"values": [{"id": 33, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "Reads in peaks", "software": "custom_content", "title": "Number of reads in peaks", "xlab": "", "ylab": ""}}]
saveLog	`false`
title	`""`

Step 4: bin_size:
- step_state: scheduled

Step 5: Cutadapt (remove adapter + bad quality bases):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmp54uix5l3/files/9/8/7/dataset_9877a420-a4a6-4916-8f88-a33ce85fee82.dat' 'SRR891268_chr22_enriched_1.fq' &&  ln -f -s '/tmp/tmp54uix5l3/files/c/2/e/dataset_c2e6a710-0bd2-4d0c-9851-6d125d9180fa.dat' 'SRR891268_chr22_enriched_2.fq' &&    cutadapt  -j=${GALAXY_SLOTS:-4}       -a 'Nextera R1'='CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'             -A 'Dummy-Adapter (do not use me)'='TGTAGGCC'       --output='out1.fq' --paired-output='out2.fq'  --error-rate=0.1 --times=1 --overlap=3    --action=trim      --minimum-length=15 --pair-filter=any    --quality-cutoff=30      'SRR891268_chr22_enriched_1.fq' 'SRR891268_chr22_enriched_2.fq'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}`
chromInfo	`"/tmp/tmp54uix5l3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_cassava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "minimum_length": "15", "pair_filter": "any"}`
library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTCCGAGCCCACGAGAC", "adapter_name": "Nextera R1", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [{"__index__": 0, "adapter_source": {"__current_case__": 1, "adapter": "TGTAGGCC", "adapter_source_list": "builtin"}, "single_noindels": false}], "anywhere_adapters2": [], "cut2": "0", "front_adapters2": [], "maximum_length2": null, "minimum_length2": null, "quality_cutoff2": ""}, "type": "paired_collection"}
output_selector	`["report"]`
read_mod_options	`{"cut": "0", "length_tag": "", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "rename": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "strip_suffix": "", "trim_n": false, "zero_cap": false}`

Step 6: Bowtie2 map on reference:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmp54uix5l3/files/7/c/d/dataset_7cdd7b0b-d569-4589-91cf-3198fc9af75e.dat' input_f.fastq &&  ln -f -s '/tmp/tmp54uix5l3/files/7/3/e/dataset_73eb740e-5ae2-4bb8-94f8-46cabb46b2ba.dat' input_r.fastq &&    bowtie2  -p ${GALAXY_SLOTS:-4}  -x '/cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full'   -1 'input_f.fastq' -2 'input_r.fastq'              --very-sensitive   2> '/tmp/tmp54uix5l3/job_working_directory/000/4/outputs/dataset_effcccaf-2c9f-46e2-a991-eeb349576927.dat'  | samtools sort --no-PG -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp54uix5l3/job_working_directory/000/4/outputs/dataset_3c5330a8-6353-4e14-b1a6-1b0c1f9f20ea.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}`
chromInfo	`"/tmp/tmp54uix5l3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 2, "aligned_file": false, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "paired_options": {"__current_case__": 1, "paired_options_selector": "no"}, "type": "paired_collection", "unaligned_file": false}`
reference_genome	`{"__current_case__": 0, "index": "hg19", "source": "indexed"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 7: filter MAPQ30 concordant pairs and not mitochondrial pairs:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmp54uix5l3/job_working_directory/000/5/configs/tmpnnj4ell_' '/tmp/tmp54uix5l3/job_working_directory/000/5/outputs/dataset_6db084c0-7158-49ce-93c0-f4b6d0b1003f.dat' && ln -s '/tmp/tmp54uix5l3/files/3/c/5/dataset_3c5330a8-6353-4e14-b1a6-1b0c1f9f20ea.dat' localbam.bam && ln -s '/tmp/tmp54uix5l3/files/_metadata_files/5/1/a/metadata_51a7066b-1362-4230-b84e-6a29f8d432e6.dat' localbam.bam.bai && cat '/tmp/tmp54uix5l3/job_working_directory/000/5/configs/tmpnnj4ell_' && bamtools filter -script '/tmp/tmp54uix5l3/job_working_directory/000/5/configs/tmpnnj4ell_' -in localbam.bam -out '/tmp/tmp54uix5l3/job_working_directory/000/5/outputs/dataset_3bd44d24-e879-45cb-8b13-603afa119c91.dat'

Exit Code:

```
0
```

Standard Output:

        
{
    "filters": [
        {
            "id": "1",
            "mapQuality": ">=30",
            "isProperPair": "true",
            "reference": "!chrM",
            "mateReference": "!MT"
        }
    ]
}

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
conditions	[{"__index__": 0, "filters": [{"__index__": 0, "bam_property": {"__current_case__": 14, "bam_property_selector": "mapQuality", "bam_property_value": ">=30"}}, {"__index__": 1, "bam_property": {"__current_case__": 11, "bam_property_selector": "isProperPair", "bam_property_value": true}}, {"__index__": 2, "bam_property": {"__current_case__": 20, "bam_property_selector": "reference", "bam_property_value": "!chrM"}}, {"__index__": 3, "bam_property": {"__current_case__": 16, "bam_property_selector": "mateReference", "bam_property_value": "!MT"}}]}]
dbkey	`"hg19"`
rule_configuration	`{"__current_case__": 0, "rules_selector": false}`

Step 8: Get number of reads per chromosome:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmp54uix5l3/files/3/c/5/dataset_3c5330a8-6353-4e14-b1a6-1b0c1f9f20ea.dat' infile && ln -s '/tmp/tmp54uix5l3/files/_metadata_files/5/1/a/metadata_51a7066b-1362-4230-b84e-6a29f8d432e6.dat' infile.bai &&  samtools idxstats -@ $addthreads infile  > '/tmp/tmp54uix5l3/job_working_directory/000/6/outputs/dataset_ac370dfb-059d-4d74-a372-a5269c2dc08f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`

Step 9: remove PCR duplicates:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

_JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS &&   ln -sf '/tmp/tmp54uix5l3/files/3/b/d/dataset_3bd44d24-e879-45cb-8b13-603afa119c91.dat' 'SRR891268_chr22_enriched' &&  picard MarkDuplicates  --INPUT 'SRR891268_chr22_enriched' --OUTPUT '/tmp/tmp54uix5l3/job_working_directory/000/7/outputs/dataset_ad709c8c-8efa-4177-bc89-cfffafb4cf93.dat'  --METRICS_FILE '/tmp/tmp54uix5l3/job_working_directory/000/7/outputs/dataset_ddee7e10-0e19-4cbd-b261-a6b0db131f6d.dat'  --REMOVE_DUPLICATES 'true' --ASSUME_SORTED 'true'  --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES  --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100'   --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR

Exit Code:

```
0
```

Standard Error:

/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmp54uix5l3/tmp
Mar 14, 2024 12:08:15 PM com.intel.gkl.NativeLibraryLoader load
INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
comments	`[]`
dbkey	`"hg19"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`true`
validation_stringency	`"LENIENT"`

Step 10: reads in chrM/MT for multiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp54uix5l3/job_working_directory/000/8/configs/tmpmi8_61j4' '/tmp/tmp54uix5l3/files/a/c/3/dataset_ac370dfb-059d-4d74-a372-a5269c2dc08f.dat' > '/tmp/tmp54uix5l3/job_working_directory/000/8/outputs/dataset_77199701-2e8e-4a9d-83ff-ffe32ddf0024.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"92f3fe6ce1fa11ee95b56d4580c9dccd"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	` " ($1=="chrM"
dbkey	`"hg19"`

Other invocation details
- history_id
  - 87b56637e7bdac74
- history_state
  - ok
- invocation_id
  - 87b56637e7bdac74
- invocation_state
  - scheduled
- workflow_id
  - 87b56637e7bdac74

github-actions · 2024-03-14T12:39:35Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ atacseq.ga_0

Problems:

Output with path /tmp/tmpdrj16buc/mapping stats__dab83fb4-27e6-4568-9e0c-cc3b431886bb different than expected
Expected text '32872 (11.70%) aligned concordantly 0 times' in output ('280964 reads; of these:
  280964 (100.00%) were paired; of these:
    30410 (10.82%) aligned concordantly 0 times
    109333 (38.91%) aligned concordantly exactly 1 time
    141221 (50.26%) aligned concordantly >1 times
    ----
    30410 pairs aligned concordantly 0 times; of these:
      13319 (43.80%) aligned discordantly 1 time
    ----
    17091 pairs aligned 0 times concordantly or discordantly; of these:
      34182 mates make up the pairs; of these:
        6127 (17.92%) aligned 0 times
        6515 (19.06%) aligned exactly 1 time
        21540 (63.02%) aligned >1 times
98.91% overall alignment rate
')

Output with path /tmp/tmpgxj711qm/MACS2 narrowPeak__fefb57d0-52cc-4964-955c-452f8428a548 different than expected
Expected 225+-0 lines in the output found 223

Output with path /tmp/tmpqi6nrc7h/MACS2 report__f7dd6ed0-87c4-492b-b5a7-0c03a77a0ae6 different than expected
Expected text '# total tags in treatment: 234432' in output ('# This file is generated by MACS version 2.2.9.1
# Command line: callpeak -t /tmp/tmpsrn7tro1/files/9/a/8/dataset_9a8288ab-efc6-44e8-ae05-7c2ddc949ae7.dat --name SRR891268_chr22_enriched --format BED --gsize 2700000000 --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
# ARGUMENTS LIST:
# name = SRR891268_chr22_enriched
# format = BED
# ChIP-seq file = ['/tmp/tmpsrn7tro1/files/9/a/8/dataset_9a8288ab-efc6-44e8-ae05-7c2ddc949ae7.dat']
# control file = None
# effective genome size = 2.70e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
# tag size is determined as 47 bps
# total tags in treatment: 232804
# Sequencing ends will be shifted towards 5' by 100 bp(s)
# d = 200
')

Output with path /tmp/tmpu0syxtlv/Summits +-500bp (merged)__fd8c2250-72cf-470b-abb4-35b69df76f2d different than expected
Expected 213+-0 lines in the output found 211

Output with path /tmp/tmpfo0beo2x/Nb of reads in summits +-500bp__8231ceee-110b-4a43-9f17-a0d0a842ce6d different than expected
Expected line '8802' in output ('8698
')

Output with path /tmp/tmp4yu5huyn/bowtie2__205128ea-0a4c-401d-bb15-43caca0db5f9 different than expected
Expected line 'SRR891268_chr22_enriched	280964	280964	32872	108014	140078	13586	6283	7890	24399	98.88	12199.5	3141.5	3945.0' in output ('Sample	total_reads	paired_total	paired_aligned_none	paired_aligned_one	paired_aligned_multi	paired_aligned_discord_one	paired_aligned_mate_none	paired_aligned_mate_one	paired_aligned_mate_multi	overall_alignment_rate	paired_aligned_mate_multi_halved	paired_aligned_mate_none_halved	paired_aligned_mate_one_halved
SRR891268_chr22_enriched	280964	280964	30410	109333	141221	13319	6127	6515	21540	98.91	10770.0	3063.5	3257.5
')

Workflow invocation details

Invocation Messages

Steps

Step 1: PE fastq input:
- step_state: scheduled
Step 2: reference_genome:
- step_state: scheduled

Step 11: convert BAM to BED to improve peak calling:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpsrn7tro1/files/b/a/a/dataset_baa27e11-6c9a-4e43-8997-9b7d1cbf8f24.dat' ./input.bam &&  bedtools bamtobed    -i ./input.bam > '/tmp/tmpsrn7tro1/job_working_directory/000/9/outputs/dataset_9a8288ab-efc6-44e8-ae05-7c2ddc949ae7.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
ed_score	`false`
option	`""`
split	`false`
tag	`""`

Step 12: Compute fragment length histogram:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpsrn7tro1/files/b/a/a/dataset_baa27e11-6c9a-4e43-8997-9b7d1cbf8f24.dat' localbam.bam && ln -f -s '/tmp/tmpsrn7tro1/files/_metadata_files/f/8/a/metadata_f8a35f15-b34f-4d91-9fca-5cc2b65249fc.dat' localbam.bam.bai && java -jar '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/pe_histogram/bd1416eea1f0/pe_histogram/PEHistogram.jar' -B localbam.bam -I localbam.bam.bai -u 500 -p '/tmp/tmpsrn7tro1/job_working_directory/000/10/outputs/dataset_53722b13-bbf2-4ce3-8436-28fcd1092ff3.dat' -t '/tmp/tmpsrn7tro1/job_working_directory/000/10/outputs/dataset_6f9b26a3-4b31-4d38-bc50-4e29fc9a2603.dat' 1>/dev/null

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
lower_limit	`None`
upper_limit	`"500"`

Step 13: number of reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmpsrn7tro1/files/b/a/a/dataset_baa27e11-6c9a-4e43-8997-9b7d1cbf8f24.dat' infile && ln -s '/tmp/tmpsrn7tro1/files/_metadata_files/f/8/a/metadata_f8a35f15-b34f-4d91-9fca-5cc2b65249fc.dat' infile.bai &&        samtools view -@ $addthreads -c     -o outfile     infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
mode	`{"__current_case__": 0, "output_options": {"__current_case__": 1, "reads_report_type": "count"}, "outtype": "all_reads"}`

Step 14: Call Peak with MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmpsrn7tro1/files/9/a/8/dataset_9a8288ab-efc6-44e8-ae05-7c2ddc949ae7.dat'  --name SRR891268_chr22_enriched    --format BED   --gsize '2700000000'           --call-summits  --keep-dup 'all'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '-100'  2>&1 > macs2_stderr) && cp SRR891268_chr22_enriched_peaks.xls '/tmp/tmpsrn7tro1/job_working_directory/000/12/outputs/dataset_c13d77c6-0ecf-4c3f-b4c5-f927b2c56877.dat'   && ( count=`ls -1 SRR891268_chr22_enriched* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmpsrn7tro1/job_working_directory/000/12/outputs/dataset_5ece2c00-e80f-4a6e-9a52-051c1d8c8e23_files' && cp -r SRR891268_chr22_enriched* '/tmp/tmpsrn7tro1/job_working_directory/000/12/outputs/dataset_5ece2c00-e80f-4a6e-9a52-051c1d8c8e23_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmpsrn7tro1/job_working_directory/000/12/outputs/dataset_5ece2c00-e80f-4a6e-9a52-051c1d8c8e23_files' macs2_stderr > '/tmp/tmpsrn7tro1/job_working_directory/000/12/outputs/dataset_5ece2c00-e80f-4a6e-9a52-051c1d8c8e23.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

Exit Code:

```
0
```

Standard Output:

INFO  @ Thu, 14 Mar 2024 12:30:54: 
# Command line: callpeak -t /tmp/tmpsrn7tro1/files/9/a/8/dataset_9a8288ab-efc6-44e8-ae05-7c2ddc949ae7.dat --name SRR891268_chr22_enriched --format BED --gsize 2700000000 --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
# ARGUMENTS LIST:
# name = SRR891268_chr22_enriched
# format = BED
# ChIP-seq file = ['/tmp/tmpsrn7tro1/files/9/a/8/dataset_9a8288ab-efc6-44e8-ae05-7c2ddc949ae7.dat']
# control file = None
# effective genome size = 2.70e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
 
INFO  @ Thu, 14 Mar 2024 12:30:54: #1 read tag files... 
INFO  @ Thu, 14 Mar 2024 12:30:54: #1 read treatment tags... 
INFO  @ Thu, 14 Mar 2024 12:30:55: #1 tag size is determined as 47 bps 
INFO  @ Thu, 14 Mar 2024 12:30:55: #1 tag size = 47.0 
INFO  @ Thu, 14 Mar 2024 12:30:55: #1  total tags in treatment: 232804 
INFO  @ Thu, 14 Mar 2024 12:30:55: #1 finished! 
INFO  @ Thu, 14 Mar 2024 12:30:55: #2 Build Peak Model... 
INFO  @ Thu, 14 Mar 2024 12:30:55: #2 Skipped... 
INFO  @ Thu, 14 Mar 2024 12:30:55: #2 Use 200 as fragment length 
INFO  @ Thu, 14 Mar 2024 12:30:55: #2 Sequencing ends will be shifted towards 5' by 100 bp(s) 
INFO  @ Thu, 14 Mar 2024 12:30:55: #3 Call peaks... 
INFO  @ Thu, 14 Mar 2024 12:30:55: #3 Going to call summits inside each peak ... 
INFO  @ Thu, 14 Mar 2024 12:30:55: #3 Pre-compute pvalue-qvalue table... 
INFO  @ Thu, 14 Mar 2024 12:30:55: #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ Thu, 14 Mar 2024 12:30:55: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... SRR891268_chr22_enriched_treat_pileup.bdg 
INFO  @ Thu, 14 Mar 2024 12:30:55: #3   Write bedGraph files for control lambda (after scaling if necessary)... SRR891268_chr22_enriched_control_lambda.bdg 
INFO  @ Thu, 14 Mar 2024 12:30:55: #3   Pileup will be based on sequencing depth in treatment. 
INFO  @ Thu, 14 Mar 2024 12:30:55: #3 Call peaks for each chromosome... 
INFO  @ Thu, 14 Mar 2024 12:30:56: #4 Write output xls file... SRR891268_chr22_enriched_peaks.xls 
INFO  @ Thu, 14 Mar 2024 12:30:56: #4 Write peak in narrowPeak format file... SRR891268_chr22_enriched_peaks.narrowPeak 
INFO  @ Thu, 14 Mar 2024 12:30:56: #4 Write summits bed file... SRR891268_chr22_enriched_summits.bed 
INFO  @ Thu, 14 Mar 2024 12:30:56: Done!

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
advanced_options	`{"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 2, "keep_dup_options_selector": "all"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": false, "to_large": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
control	`{"__current_case__": 1, "c_select": "No"}`
cutoff_options	`{"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}`
dbkey	`"hg19"`
effective_genome_size_options	`{"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "2700000000"}`
format	`"BED"`
nomodel_type	`{"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "-100"}`
outputs	`["peaks_tabular", "summits", "bdg", "html"]`
treatment	`{"__current_case__": 0, "input_treatment_file": {"values": [{"id": 16, "src": "dce"}]}, "t_multi_select": "No"}`

Step 15: compute 1/million reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmpsrn7tro1/job_working_directory/000/13/configs/tmp25aunri9' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpsrn7tro1/files/6/5/9/dataset_6599e8b7-79db-4337-8e60-82b6518808c4.dat' '/tmp/tmpsrn7tro1/job_working_directory/000/13/outputs/dataset_971e4fec-c9db-4e0d-8819-566e7b7ac596.dat'

Exit Code:

```
0
```

Standard Output:

Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
avoid_scientific_notation	`true`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"}`

Step 16: Bigwig from MACS2 (no norm):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -v "^track" '/tmp/tmpsrn7tro1/files/b/e/9/dataset_be9d3fc7-d7c4-4768-8cfc-d3dc9755da4d.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len' '/tmp/tmpsrn7tro1/job_working_directory/000/14/outputs/dataset_99df27cc-d5c9-4e96-9904-0ac3935b177d.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 17: get summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools slop    -g '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len'  -i '/tmp/tmpsrn7tro1/files/4/e/2/dataset_4e2389f5-68e8-4d40-b8d5-21ec07f5edff.dat' -b 500  > '/tmp/tmpsrn7tro1/job_working_directory/000/15/outputs/dataset_5ece650b-a239-4440-89fd-ba8d3e4cfcfd.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
addition	`{"__current_case__": 0, "addition_select": "b", "b": "500"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
genome_file_opts	`{"__current_case__": 0, "genome": "hg19", "genome_file_opts_selector": "loc"}`
header	`false`
pct	`false`
strand	`false`

Step 18: summary of MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -P -A 0 -B 0  -i -- '^#' '/tmp/tmpsrn7tro1/files/c/1/3/dataset_c13d77c6-0ecf-4c3f-b4c5-f927b2c56877.dat' | grep -v "^--$" > '/tmp/tmpsrn7tro1/job_working_directory/000/16/outputs/dataset_f7dd6ed0-87c4-492b-b5a7-0c03a77a0ae6.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
case_sensitive	`"-i"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
color	`"NOCOLOR"`
dbkey	`"hg19"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-P"`
url_paste	`"^#"`

Step 19: Convert 1/million reads to parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
param_type	`"text"`
remove_newlines	`true`

Step 20: Isolate each bigwig do normalize not average:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
input	`{"values": [{"id": 23, "src": "hdca"}]}`
rules	{"mapping": [{"collapsible_value": {"__class__": "RuntimeValue"}, "columns": [0, 1], "connectable": true, "editing": false, "is_workflow": false, "type": "list_identifiers"}], "rules": [{"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}]}

Step 3: effective_genome_size:
- step_state: scheduled

Step 21: Merge summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mergeBed -i '/tmp/tmpsrn7tro1/files/5/e/c/dataset_5ece650b-a239-4440-89fd-ba8d3e4cfcfd.dat'  -d 0    > '/tmp/tmpsrn7tro1/job_working_directory/000/18/outputs/dataset_fd8c2250-72cf-470b-abb4-35b69df76f2d.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
c_and_o_argument_repeat	`[]`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
distance	`"0"`
header	`false`
strand	`""`

Step 22: normalize by million reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmpsrn7tro1/files/9/9/d/dataset_99df27cc-d5c9-4e96-9904-0ac3935b177d.dat --outFileName '/tmp/tmpsrn7tro1/job_working_directory/000/27/outputs/dataset_7f8e23fe-72e5-40ba-9d3e-7526c134be19.dat' --outFileFormat 'bigwig'     --scaleFactors '4.295458840913386' --binSize 1000

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
advancedOpt	`{"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "4.295458840913386", "showAdvancedOpt": "yes", "skipNAs": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
outFileFormat	`"bigwig"`
region	`""`

Step 23: Compute coverage on summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools coverage        -a '/tmp/tmpsrn7tro1/files/f/d/8/dataset_fd8c2250-72cf-470b-abb4-35b69df76f2d.dat' -b '/tmp/tmpsrn7tro1/files/b/a/a/dataset_baa27e11-6c9a-4e43-8997-9b7d1cbf8f24.dat'      | sort -k1,1 -k2,2n > '/tmp/tmpsrn7tro1/job_working_directory/000/19/outputs/dataset_ae1d6e6e-c6b0-4dca-8f3f-d8931cb8be15.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
a_or_b	`false`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
d	`false`
dbkey	`"hg19"`
hist	`false`
mean	`false`
overlap_a	`None`
overlap_b	`None`
reciprocal_overlap	`false`
reduce_or_iterate	`{"__current_case__": 0, "inputB": {"values": [{"id": 14, "src": "dce"}]}, "reduce_or_iterate_selector": "iterate"}`
sorted	`false`
split	`false`
strandedness	`false`

Step 24: number of reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpsrn7tro1/job_working_directory/000/20/configs/tmplktptcx7' '/tmp/tmpsrn7tro1/files/a/e/1/dataset_ae1d6e6e-c6b0-4dca-8f3f-d8931cb8be15.dat' > '/tmp/tmpsrn7tro1/job_working_directory/000/20/outputs/dataset_8231ceee-110b-4a43-9f17-a0d0a842ce6d.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	`"{S=S+$4}END{print S}"`
dbkey	`"hg19"`

Step 25: compute 1/million reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmpsrn7tro1/job_working_directory/000/21/configs/tmpliosz_l7' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpsrn7tro1/files/8/2/3/dataset_8231ceee-110b-4a43-9f17-a0d0a842ce6d.dat' '/tmp/tmpsrn7tro1/job_working_directory/000/21/outputs/dataset_aef09f0a-3fde-4c9d-adac-8118300651d5.dat'

Exit Code:

```
0
```

Standard Output:

Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
avoid_scientific_notation	`true`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"}`

Step 26: Combine number of reads in peaks with total number of reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmpsrn7tro1/galaxy-dev/tools/filters/catWrapper.py '/tmp/tmpsrn7tro1/job_working_directory/000/22/outputs/dataset_dab26f4e-5df8-4caa-b42b-11f744588c5f.dat' '/tmp/tmpsrn7tro1/files/8/2/3/dataset_8231ceee-110b-4a43-9f17-a0d0a842ce6d.dat' '/tmp/tmpsrn7tro1/files/6/5/9/dataset_6599e8b7-79db-4337-8e60-82b6518808c4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
queries	`[{"__index__": 0, "input2": {"values": [{"id": 19, "src": "dce"}]}}]`

Step 27: Convert 1/million reads in peaks to parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
param_type	`"text"`
remove_newlines	`true`

Step 28: reads in peaks multiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpsrn7tro1/job_working_directory/000/24/configs/tmpzdtkw71x' '/tmp/tmpsrn7tro1/files/d/a/b/dataset_dab26f4e-5df8-4caa-b42b-11f744588c5f.dat' > '/tmp/tmpsrn7tro1/job_working_directory/000/24/outputs/dataset_5a780f71-da94-4d45-bb22-f5f71ef71a20.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	`" NR==1{print \"in peaks\",$1;inp=$1}NR==2{print \"outside peaks\",$1 - inp}"`
dbkey	`"hg19"`

Step 29: normalize by million reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmpsrn7tro1/files/9/9/d/dataset_99df27cc-d5c9-4e96-9904-0ac3935b177d.dat --outFileName '/tmp/tmpsrn7tro1/job_working_directory/000/28/outputs/dataset_3c1e781f-b567-480d-809f-45d2cca9ba41.dat' --outFileFormat 'bigwig'     --scaleFactors '114.96895838123707' --binSize 1000

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
advancedOpt	`{"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "114.96895838123707", "showAdvancedOpt": "yes", "skipNAs": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
outFileFormat	`"bigwig"`
region	`""`

Step 30: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&    ln -s '/tmp/tmpsrn7tro1/files/b/d/b/dataset_bdbad1da-aa61-488e-a816-98ca596ff0bc.dat' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" && mkdir multiqc_WDir/bowtie2_1 &&        grep -q '% overall alignment rate' /tmp/tmpsrn7tro1/files/d/a/b/dataset_dab83fb4-27e6-4568-9e0c-cc3b431886bb.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmpsrn7tro1/files/d/a/b/dataset_dab83fb4-27e6-4568-9e0c-cc3b431886bb.dat' 'multiqc_WDir/bowtie2_1/SRR891268_chr22_enriched'  &&   mkdir multiqc_WDir/custom_content_2 && ln -s '/tmp/tmpsrn7tro1/files/8/0/a/dataset_80ad518c-762b-4366-bc9e-24b421ab71f6.dat' 'multiqc_WDir/custom_content_2/file_2_0' && more /tmp/tmpsrn7tro1/files/8/0/a/dataset_80ad518c-762b-4366-bc9e-24b421ab71f6.dat && mkdir multiqc_WDir/picard_3 &&      mkdir 'multiqc_WDir/picard_3/markdups_0' &&    grep -q 'MarkDuplicates' /tmp/tmpsrn7tro1/files/8/3/a/dataset_83a6fb36-cb21-470a-89c4-c67056d2fe57.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmpsrn7tro1/files/8/3/a/dataset_83a6fb36-cb21-470a-89c4-c67056d2fe57.dat' 'multiqc_WDir/picard_3/markdups_0/SRR891268_chr22_enriched'  &&    mkdir multiqc_WDir/custom_content_4 && ln -s '/tmp/tmpsrn7tro1/files/6/f/9/dataset_6f9b26a3-4b31-4d38-bc50-4e29fc9a2603.dat' 'multiqc_WDir/custom_content_4/file_4_0' && more /tmp/tmpsrn7tro1/files/6/f/9/dataset_6f9b26a3-4b31-4d38-bc50-4e29fc9a2603.dat && mkdir multiqc_WDir/macs2_5 &&    grep -q "# This file is generated by MACS" /tmp/tmpsrn7tro1/files/c/1/3/dataset_c13d77c6-0ecf-4c3f-b4c5-f927b2c56877.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmpsrn7tro1/files/c/1/3/dataset_c13d77c6-0ecf-4c3f-b4c5-f927b2c56877.dat' 'multiqc_WDir/macs2_5/SRR891268_chr22_enriched_peaks.xls' && mkdir multiqc_WDir/custom_content_6 && ln -s '/tmp/tmpsrn7tro1/files/5/a/7/dataset_5a780f71-da94-4d45-bb22-f5f71ef71a20.dat' 'multiqc_WDir/custom_content_6/file_6_0' && more /tmp/tmpsrn7tro1/files/5/a/7/dataset_5a780f71-da94-4d45-bb22-f5f71ef71a20.dat &&  multiqc multiqc_WDir --filename 'report'    --export  --config '/tmp/tmpsrn7tro1/job_working_directory/000/25/configs/tmpvrjbvqoq'

Exit Code:

```
0
```

Standard Error:

  /// MultiQC 🔍 | v1.11

|           multiqc | MultiQC Version v1.21 now available!
|           multiqc | Search path : /tmp/tmpsrn7tro1/job_working_directory/000/25/working/multiqc_WDir
|    custom_content | Could not parse comment file header for MultiQC custom content: file_4_0
|    custom_content | section_2: Found 1 samples (bargraph)
|    custom_content | section_4: Found 1 samples (linegraph)
|    custom_content | section_6: Found 1 samples (bargraph)
|             macs2 | Found 1 logs
|            picard | Found 1 MarkDuplicates reports
|           bowtie2 | Found 1 reports
|          cutadapt | Found 1 reports
|           multiqc | Compressing plot data
|           multiqc | Report      : report.html
|           multiqc | Data        : report_data
|           multiqc | Plots       : report_plots
|           multiqc | MultiQC complete

Standard Output:

::::::::::::::
/tmp/tmpsrn7tro1/files/8/0/a/dataset_80ad518c-762b-4366-bc9e-24b421ab71f6.dat
::::::::::::::
chrM	216347
others	339454
::::::::::::::
/tmp/tmpsrn7tro1/files/6/f/9/dataset_6f9b26a3-4b31-4d38-bc50-4e29fc9a2603.dat
::::::::::::::
# localbam.bam
# Chromosome_ID	Chromosome_Size	Aligned_Reads
# chr10	135534747	5214.0
# chr11	135006516	5674.0
# chr11_gl000202_random	40103	0.0
# chr12	133851895	5404.0
# chr13	115169878	3794.0
# chr14	107349540	3422.0
# chr15	102531392	2518.0
# chr16	90354753	3218.0
# chr17_ctg5_hap1	1680828	0.0
# chr17	81195210	2880.0
# chr17_gl000203_random	37498	0.0
# chr17_gl000204_random	81310	0.0
# chr17_gl000205_random	174588	42.0
# chr17_gl000206_random	41001	0.0
# chr18	78077248	3012.0
# chr18_gl000207_random	4262	0.0
# chr19	59128983	2580.0
# chr19_gl000208_random	92689	2.0
# chr19_gl000209_random	159169	0.0
# chr1	249250621	9842.0
# chr1_gl000191_random	106433	2.0
# chr1_gl000192_random	547496	4.0
# chr20	63025520	2366.0
# chr21	48129895	1214.0
# chr21_gl000210_random	27682	0.0
# chr22	51304566	116840.0
# chr2	243199373	10050.0
# chr3	198022430	8394.0
# chr4_ctg9_hap1	590426	0.0
# chr4	191154276	8172.0
# chr4_gl000193_random	189789	2.0
# chr4_gl000194_random	191469	4.0
# chr5	180915260	7536.0
# chr6_apd_hap1	4622290	0.0
# chr6_cox_hap2	4795371	2.0
# chr6_dbb_hap3	4610396	0.0
# chr6	171115067	7054.0
# chr6_mann_hap4	4683263	2.0
# chr6_mcf_hap5	4833398	0.0
# chr6_qbl_hap6	4611984	0.0
# chr6_ssto_hap7	4928567	0.0
# chr7	159138663	6548.0
# chr7_gl000195_random	182896	16.0
# chr8	146364022	6326.0
# chr8_gl000196_random	38914	0.0
# chr8_gl000197_random	37175	0.0
# chr9	141213431	4420.0
# chr9_gl000198_random	90085	22.0
# chr9_gl000199_random	169874	2.0
# chr9_gl000200_random	187035	0.0
# chr9_gl000201_random	36148	0.0
# chrM	16571	0.0
# chrUn_gl000211	166566	6.0
# chrUn_gl000212	186858	2.0
# chrUn_gl000213	164239	0.0
# chrUn_gl000214	137718	10.0
# chrUn_gl000215	172545	0.0
# chrUn_gl000216	172294	2.0
# chrUn_gl000217	172149	24.0
# chrUn_gl000218	161147	0.0
# chrUn_gl000219	179198	10.0
# chrUn_gl000220	161802	236.0
# chrUn_gl000221	155397	2.0
# chrUn_gl000222	186861	0.0
# chrUn_gl000223	180455	0.0
# chrUn_gl000224	179693	8.0
# chrUn_gl000225	211173	8.0
# chrUn_gl000226	15008	6.0
# chrUn_gl000227	128374	0.0
# chrUn_gl000228	129120	0.0
# chrUn_gl000229	19913	82.0
# chrUn_gl000230	43691	8.0
# chrUn_gl000231	27386	84.0
# chrUn_gl000232	40652	158.0
# chrUn_gl000233	45941	32.0
# chrUn_gl000234	40531	122.0
# chrUn_gl000235	34474	50.0
# chrUn_gl000236	41934	0.0
# chrUn_gl000237	45867	66.0
# chrUn_gl000238	39939	2.0
# chrUn_gl000239	33824	2.0
# chrUn_gl000240	41933	12.0
# chrUn_gl000241	42152	118.0
# chrUn_gl000242	43523	10.0
# chrUn_gl000243	43341	12.0
# chrUn_gl000244	39929	0.0
# chrUn_gl000245	36651	2.0
# chrUn_gl000246	38154	6.0
# chrUn_gl000247	36422	0.0
# chrUn_gl000248	39786	6.0
# chrUn_gl000249	38502	0.0
# chrX	155270560	5134.0
# chrY	59373566	6.0
# Total Genome Size: 3.137161264E9	Total Aligned Tags: 232804.0
# bowtie2	# 2.5.3
# "/usr/local/bin/bowtie2-align-s --wrapper basic-0 -p 1 -x /cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full --very-sensitive -1 input_f.fastq -2 input_r.fastq"
# MarkDuplicates	# Version:3.1.1
# MarkDuplicates --TAGGING_POLICY All --INPUT SRR891268_chr22_enriched --OUTPUT /tmp/tmpsrn7tro1/job_working_directory/000/7/outputs/dataset_baa27e11-6c9a-4e43-8997-9b7d1cbf8f24.dat --METRICS_FILE /tmp/tmpsrn7tro1/job_working_directory/000/7/outputs/dataset_83a6fb36-cb21-470a-89c4-c67056d2fe57.dat --REMOVE_DUPLICATES true --ASSUME_SORTED true --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --VERBOSITY ERROR --QUIET true --VALIDATION_STRINGENCY LENIENT --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX <optimized capture of last three ':' separated fields as numeric values> --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false
# Average Insert Size: 162.46371196371197
# Median Insert Size: 126.0
# Std deviation of Insert Size: 117.9037267671474
# Number of ReadPairs: 116402.0
# Histogram
# Size (bp)	Frequency
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.0
20	0.0
21	0.0
22	0.0
23	1.0
24	1.0
25	11.0
26	142.0
27	117.0
28	131.0
29	130.0
30	90.0
31	88.0
32	101.0
33	116.0
34	199.0
35	385.0
36	613.0
37	761.0
38	827.0
39	1076.0
40	1305.0
41	1453.0
42	1503.0
43	1415.0
44	1214.0
45	1206.0
46	1057.0
47	969.0
48	14.0
49	19.0
50	1190.0
51	1450.0
52	1335.0
53	1142.0
54	1041.0
55	1022.0
56	934.0
57	779.0
58	759.0
59	711.0
60	711.0
61	880.0
62	926.0
63	835.0
64	905.0
65	885.0
66	765.0
67	697.0
68	651.0
69	598.0
70	638.0
71	717.0
72	749.0
73	770.0
74	736.0
75	677.0
76	653.0
77	578.0
78	569.0
79	530.0
80	508.0
81	594.0
82	631.0
83	584.0
84	605.0
85	579.0
86	593.0
87	544.0
88	487.0
89	439.0
90	395.0
91	420.0
92	469.0
93	512.0
94	484.0
95	502.0
96	473.0
97	431.0
98	380.0
99	348.0
100	350.0
101	380.0
102	343.0
103	371.0
104	420.0
105	410.0
106	414.0
107	364.0
108	363.0
109	301.0
110	281.0
111	314.0
112	306.0
113	337.0
114	331.0
115	321.0
116	329.0
117	352.0
118	293.0
119	276.0
120	261.0
121	261.0
122	254.0
123	266.0
124	250.0
125	263.0
126	294.0
127	265.0
128	256.0
129	261.0
130	250.0
131	234.0
132	209.0
133	245.0
134	253.0
135	238.0
136	272.0
137	304.0
138	288.0
139	287.0
140	248.0
141	238.0
142	225.0
143	193.0
144	221.0
145	219.0
146	226.0
147	266.0
148	238.0
149	240.0
150	268.0
151	267.0
152	255.0
153	258.0
154	212.0
155	221.0
156	229.0
157	249.0
158	256.0
159	267.0
160	228.0
161	239.0
162	255.0
163	221.0
164	232.0
165	300.0
166	330.0
167	387.0
168	371.0
169	345.0
170	288.0
171	299.0
172	251.0
173	251.0
174	303.0
175	353.0
176	370.0
177	383.0
178	421.0
179	351.0
180	289.0
181	321.0
182	270.0
183	270.0
184	322.0
185	315.0
186	324.0
187	339.0
188	348.0
189	334.0
190	305.0
191	309.0
192	291.0
193	303.0
194	323.0
195	374.0
196	348.0
197	343.0
198	306.0
199	317.0
200	308.0
201	314.0
202	307.0
203	340.0
204	349.0
205	336.0
206	340.0
207	342.0
208	314.0
209	287.0
210	330.0
211	340.0
212	297.0
213	318.0
214	272.0
215	321.0
216	336.0
217	324.0
218	347.0
219	297.0
220	314.0
221	285.0
222	286.0
223	270.0
224	305.0
225	307.0
226	287.0
227	283.0
228	289.0
229	256.0
230	284.0
231	275.0
232	265.0
233	250.0
234	256.0
235	239.0
236	226.0
237	237.0
238	225.0
239	232.0
240	214.0
241	221.0
242	235.0
243	211.0
244	170.0
245	202.0
246	218.0
247	214.0
248	178.0
249	158.0
250	185.0
251	175.0
252	158.0
253	181.0
254	192.0
255	172.0
256	143.0
257	140.0
258	156.0
259	159.0
260	143.0
261	126.0
262	160.0
263	126.0
264	128.0
265	132.0
266	139.0
267	109.0
268	134.0
269	110.0
270	122.0
271	116.0
272	126.0
273	96.0
274	120.0
275	119.0
276	123.0
277	120.0
278	125.0
279	95.0
280	99.0
281	124.0
282	113.0
283	121.0
284	113.0
285	79.0
286	88.0
287	89.0
288	105.0
289	105.0
290	101.0
291	82.0
292	100.0
293	104.0
294	97.0
295	102.0
296	95.0
297	102.0
298	96.0
299	98.0
300	98.0
301	109.0
302	115.0
303	96.0
304	85.0
305	75.0
306	84.0
307	94.0
308	119.0
309	81.0
310	98.0
311	94.0
312	101.0
313	95.0
314	87.0
315	93.0
316	102.0
317	77.0
318	91.0
319	104.0
320	100.0
321	92.0
322	82.0
323	76.0
324	82.0
325	106.0
326	101.0
327	92.0
328	83.0
329	86.0
330	91.0
331	98.0
332	78.0
333	79.0
334	98.0
335	79.0
336	93.0
337	92.0
338	94.0
339	88.0
340	77.0
341	95.0
342	89.0
343	112.0
344	90.0
345	119.0
346	106.0
347	108.0
348	113.0
349	77.0
350	95.0
351	95.0
352	96.0
353	99.0
354	97.0
355	118.0
356	92.0
357	101.0
358	99.0
359	90.0
360	103.0
361	103.0
362	109.0
363	119.0
364	117.0
365	105.0
366	123.0
367	115.0
368	121.0
369	123.0
370	112.0
371	121.0
372	115.0
373	94.0
374	116.0
375	113.0
376	106.0
377	112.0
378	103.0
379	113.0
380	104.0
381	105.0
382	114.0
383	109.0
384	110.0
385	107.0
386	110.0
387	113.0
388	115.0
389	128.0
390	130.0
391	112.0
392	128.0
393	95.0
394	119.0
395	111.0
396	109.0
397	111.0
398	115.0
399	103.0
400	106.0
401	113.0
402	107.0
403	118.0
404	103.0
405	93.0
406	111.0
407	113.0
408	130.0
409	106.0
410	102.0
411	97.0
412	92.0
413	112.0
414	101.0
415	96.0
416	93.0
417	89.0
418	102.0
419	96.0
420	98.0
421	108.0
422	92.0
423	95.0
424	80.0
425	76.0
426	103.0
427	90.0
428	80.0
429	82.0
430	94.0
431	93.0
432	84.0
433	77.0
434	91.0
435	90.0
436	72.0
437	78.0
438	71.0
439	66.0
440	77.0
441	80.0
442	78.0
443	68.0
444	63.0
445	71.0
446	70.0
447	78.0
448	56.0
449	61.0
450	59.0
451	60.0
452	49.0
453	59.0
454	65.0
455	73.0
456	56.0
457	50.0
458	72.0
459	52.0
460	60.0
461	67.0
462	57.0
463	61.0
464	53.0
465	50.0
466	52.0
467	58.0
468	44.0
469	64.0
470	52.0
471	57.0
472	47.0
473	63.0
474	48.0
475	53.0
476	57.0
477	41.0
478	49.0
479	50.0
480	60.0
481	46.0
482	42.0
483	51.0
484	47.0
485	35.0
486	40.0
487	41.0
488	51.0
489	44.0
490	36.0
491	37.0
492	48.0
493	52.0
494	49.0
495	52.0
496	56.0
497	50.0
498	42.0
499	49.0
500	46.0
::::::::::::::
/tmp/tmpsrn7tro1/files/5/a/7/dataset_5a780f71-da94-4d45-bb22-f5f71ef71a20.dat
::::::::::::::
in peaks	8698
outside peaks	224106
|         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 8/8

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
comment	`""`
dbkey	`"hg19"`
export	`true`
flat	`false`
results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 11, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "chrM", "software": "custom_content", "title": "reads mapping on chrM", "xlab": "", "ylab": ""}}, {"__index__": 3, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 9, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}, {"__index__": 4, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 14, "src": "hdca"}]}, "plot_type": "linegraph", "section_name": "Fragment size", "software": "custom_content", "title": "Fragment size distribution", "xlab": "", "ylab": ""}}, {"__index__": 5, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 16, "src": "hdca"}]}, "software": "macs2"}}, {"__index__": 6, "software_cond": {"__current_case__": 32, "description": "Number of reads falling 500bp from a summit", "input": {"values": [{"id": 33, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "Reads in peaks", "software": "custom_content", "title": "Number of reads in peaks", "xlab": "", "ylab": ""}}]
saveLog	`false`
title	`""`

Step 4: bin_size:
- step_state: scheduled

Step 5: Cutadapt (remove adapter + bad quality bases):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmpsrn7tro1/files/6/3/2/dataset_63266b23-a94d-48cf-ab78-0be4f85464d7.dat' 'SRR891268_chr22_enriched_1.fq' &&  ln -f -s '/tmp/tmpsrn7tro1/files/3/7/4/dataset_37477842-f0c8-47ac-9144-1e2569ccf2a2.dat' 'SRR891268_chr22_enriched_2.fq' &&    cutadapt  -j=${GALAXY_SLOTS:-4}       -a 'Nextera R1'='CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'             -A 'Nextera R2'='CTGTCTCTTATACACATCTGACGCTGCCGACGA'       --output='out1.fq' --paired-output='out2.fq'  --error-rate=0.1 --times=1 --overlap=3    --action=trim      --minimum-length=15 --pair-filter=any    --quality-cutoff=30      'SRR891268_chr22_enriched_1.fq' 'SRR891268_chr22_enriched_2.fq'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}`
chromInfo	`"/tmp/tmpsrn7tro1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_cassava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "minimum_length": "15", "pair_filter": "any"}`
library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTCCGAGCCCACGAGAC", "adapter_name": "Nextera R1", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTGACGCTGCCGACGA", "adapter_name": "Nextera R2", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters2": [], "cut2": "0", "front_adapters2": [], "maximum_length2": null, "minimum_length2": null, "quality_cutoff2": ""}, "type": "paired_collection"}
output_selector	`["report"]`
read_mod_options	`{"cut": "0", "length_tag": "", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "rename": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "strip_suffix": "", "trim_n": false, "zero_cap": false}`

Step 6: Bowtie2 map on reference:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmpsrn7tro1/files/4/8/2/dataset_4824323a-7d18-48bc-8c0f-b9e3d2ba5aba.dat' input_f.fastq &&  ln -f -s '/tmp/tmpsrn7tro1/files/9/5/0/dataset_9502eca0-0c2c-4f2b-83f3-7dc1e5583c89.dat' input_r.fastq &&    bowtie2  -p ${GALAXY_SLOTS:-4}  -x '/cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full'   -1 'input_f.fastq' -2 'input_r.fastq'              --very-sensitive   2> '/tmp/tmpsrn7tro1/job_working_directory/000/4/outputs/dataset_dab83fb4-27e6-4568-9e0c-cc3b431886bb.dat'  | samtools sort --no-PG -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmpsrn7tro1/job_working_directory/000/4/outputs/dataset_154d2490-19b2-449d-b675-c16fe15f29b5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}`
chromInfo	`"/tmp/tmpsrn7tro1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 2, "aligned_file": false, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "paired_options": {"__current_case__": 1, "paired_options_selector": "no"}, "type": "paired_collection", "unaligned_file": false}`
reference_genome	`{"__current_case__": 0, "index": "hg19", "source": "indexed"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 7: filter MAPQ30 concordant pairs and not mitochondrial pairs:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmpsrn7tro1/job_working_directory/000/5/configs/tmp28_fw72p' '/tmp/tmpsrn7tro1/job_working_directory/000/5/outputs/dataset_ced0e8c9-b772-4ddb-842e-bccc9c689eda.dat' && ln -s '/tmp/tmpsrn7tro1/files/1/5/4/dataset_154d2490-19b2-449d-b675-c16fe15f29b5.dat' localbam.bam && ln -s '/tmp/tmpsrn7tro1/files/_metadata_files/9/9/0/metadata_99085e30-7be6-4b93-851e-465f1347dfda.dat' localbam.bam.bai && cat '/tmp/tmpsrn7tro1/job_working_directory/000/5/configs/tmp28_fw72p' && bamtools filter -script '/tmp/tmpsrn7tro1/job_working_directory/000/5/configs/tmp28_fw72p' -in localbam.bam -out '/tmp/tmpsrn7tro1/job_working_directory/000/5/outputs/dataset_edd4a9d4-aff2-4df3-bb5f-d4c7ad5a4ff7.dat'

Exit Code:

```
0
```

Standard Output:

        
{
    "filters": [
        {
            "id": "1",
            "mapQuality": ">=30",
            "isProperPair": "true",
            "reference": "!chrM",
            "mateReference": "!MT"
        }
    ]
}

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
conditions	[{"__index__": 0, "filters": [{"__index__": 0, "bam_property": {"__current_case__": 14, "bam_property_selector": "mapQuality", "bam_property_value": ">=30"}}, {"__index__": 1, "bam_property": {"__current_case__": 11, "bam_property_selector": "isProperPair", "bam_property_value": true}}, {"__index__": 2, "bam_property": {"__current_case__": 20, "bam_property_selector": "reference", "bam_property_value": "!chrM"}}, {"__index__": 3, "bam_property": {"__current_case__": 16, "bam_property_selector": "mateReference", "bam_property_value": "!MT"}}]}]
dbkey	`"hg19"`
rule_configuration	`{"__current_case__": 0, "rules_selector": false}`

Step 8: Get number of reads per chromosome:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmpsrn7tro1/files/1/5/4/dataset_154d2490-19b2-449d-b675-c16fe15f29b5.dat' infile && ln -s '/tmp/tmpsrn7tro1/files/_metadata_files/9/9/0/metadata_99085e30-7be6-4b93-851e-465f1347dfda.dat' infile.bai &&  samtools idxstats -@ $addthreads infile  > '/tmp/tmpsrn7tro1/job_working_directory/000/6/outputs/dataset_2f8516f0-d808-4b0b-8ccd-4ade96df6206.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`

Step 9: remove PCR duplicates:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

_JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS &&   ln -sf '/tmp/tmpsrn7tro1/files/e/d/d/dataset_edd4a9d4-aff2-4df3-bb5f-d4c7ad5a4ff7.dat' 'SRR891268_chr22_enriched' &&  picard MarkDuplicates  --INPUT 'SRR891268_chr22_enriched' --OUTPUT '/tmp/tmpsrn7tro1/job_working_directory/000/7/outputs/dataset_baa27e11-6c9a-4e43-8997-9b7d1cbf8f24.dat'  --METRICS_FILE '/tmp/tmpsrn7tro1/job_working_directory/000/7/outputs/dataset_83a6fb36-cb21-470a-89c4-c67056d2fe57.dat'  --REMOVE_DUPLICATES 'true' --ASSUME_SORTED 'true'  --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES  --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100'   --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR

Exit Code:

```
0
```

Standard Error:

/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmpsrn7tro1/tmp
Mar 14, 2024 12:30:09 PM com.intel.gkl.NativeLibraryLoader load
INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
comments	`[]`
dbkey	`"hg19"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`true`
validation_stringency	`"LENIENT"`

Step 10: reads in chrM/MT for multiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpsrn7tro1/job_working_directory/000/8/configs/tmpsgwddrmk' '/tmp/tmpsrn7tro1/files/2/f/8/dataset_2f8516f0-d808-4b0b-8ccd-4ade96df6206.dat' > '/tmp/tmpsrn7tro1/job_working_directory/000/8/outputs/dataset_80ad518c-762b-4366-bc9e-24b421ab71f6.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"99c0b7bee1fd11ee81122f1b9cc087f3"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	` " ($1=="chrM"
dbkey	`"hg19"`

Other invocation details
- history_id
  - f7f43626fbf81e20
- history_state
  - ok
- invocation_id
  - f7f43626fbf81e20
- invocation_state
  - scheduled
- workflow_id
  - f7f43626fbf81e20

github-actions · 2024-03-14T13:39:35Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ atacseq.ga_0

Problems:

Output with path /tmp/tmp5ra1_5p7/general_stats__3a506a5b-7a5b-4ac8-9da4-9c445d9cd17b different than expected
Expected text 'SRR891268_chr22_enriched	200.0	223	0.028487	98.88' in output ('Sample	MACS2_mqc-generalstats-macs2-d	MACS2_mqc-generalstats-macs2-peak_count	Picard_mqc-generalstats-picard-PERCENT_DUPLICATION	Bowtie 2 / HiSAT2_mqc-generalstats-bowtie_2_hisat2-overall_alignment_rate	Cutadapt_mqc-generalstats-cutadapt-percent_trimmed
SRR891268_chr22_enriched	200.0	223	0.028469	98.91	
SRR891268_chr22_enriched_2					4.771948521807416
')

Workflow invocation details

Invocation Messages

Steps

Step 1: PE fastq input:
- step_state: scheduled
Step 2: reference_genome:
- step_state: scheduled

Step 11: convert BAM to BED to improve peak calling:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp89xn9jz6/files/4/e/1/dataset_4e1ae64e-a9b6-4dc7-89e1-5266cd927db3.dat' ./input.bam &&  bedtools bamtobed    -i ./input.bam > '/tmp/tmp89xn9jz6/job_working_directory/000/9/outputs/dataset_67fdf7ff-a7e9-40be-8906-430d5a80d12e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
ed_score	`false`
option	`""`
split	`false`
tag	`""`

Step 12: Compute fragment length histogram:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp89xn9jz6/files/4/e/1/dataset_4e1ae64e-a9b6-4dc7-89e1-5266cd927db3.dat' localbam.bam && ln -f -s '/tmp/tmp89xn9jz6/files/_metadata_files/b/e/9/metadata_be9cf7a3-5692-4172-80ca-2bb383970c3d.dat' localbam.bam.bai && java -jar '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/pe_histogram/bd1416eea1f0/pe_histogram/PEHistogram.jar' -B localbam.bam -I localbam.bam.bai -u 500 -p '/tmp/tmp89xn9jz6/job_working_directory/000/10/outputs/dataset_930e4fd7-d475-43c8-9059-a252f78776b1.dat' -t '/tmp/tmp89xn9jz6/job_working_directory/000/10/outputs/dataset_e664b7db-2cac-4cc5-9419-ac95c988e89f.dat' 1>/dev/null

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
lower_limit	`None`
upper_limit	`"500"`

Step 13: number of reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp89xn9jz6/files/4/e/1/dataset_4e1ae64e-a9b6-4dc7-89e1-5266cd927db3.dat' infile && ln -s '/tmp/tmp89xn9jz6/files/_metadata_files/b/e/9/metadata_be9cf7a3-5692-4172-80ca-2bb383970c3d.dat' infile.bai &&        samtools view -@ $addthreads -c     -o outfile     infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
mode	`{"__current_case__": 0, "output_options": {"__current_case__": 1, "reads_report_type": "count"}, "outtype": "all_reads"}`

Step 14: Call Peak with MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmp89xn9jz6/files/6/7/f/dataset_67fdf7ff-a7e9-40be-8906-430d5a80d12e.dat'  --name SRR891268_chr22_enriched    --format BED   --gsize '2700000000'           --call-summits  --keep-dup 'all'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '-100'  2>&1 > macs2_stderr) && cp SRR891268_chr22_enriched_peaks.xls '/tmp/tmp89xn9jz6/job_working_directory/000/12/outputs/dataset_756519d3-7da7-4978-a707-072d0619aaef.dat'   && ( count=`ls -1 SRR891268_chr22_enriched* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmp89xn9jz6/job_working_directory/000/12/outputs/dataset_31cbd2e0-984e-4909-97f8-a9265d7d61ef_files' && cp -r SRR891268_chr22_enriched* '/tmp/tmp89xn9jz6/job_working_directory/000/12/outputs/dataset_31cbd2e0-984e-4909-97f8-a9265d7d61ef_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmp89xn9jz6/job_working_directory/000/12/outputs/dataset_31cbd2e0-984e-4909-97f8-a9265d7d61ef_files' macs2_stderr > '/tmp/tmp89xn9jz6/job_working_directory/000/12/outputs/dataset_31cbd2e0-984e-4909-97f8-a9265d7d61ef.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

Exit Code:

```
0
```

Standard Output:

INFO  @ Thu, 14 Mar 2024 13:30:51: 
# Command line: callpeak -t /tmp/tmp89xn9jz6/files/6/7/f/dataset_67fdf7ff-a7e9-40be-8906-430d5a80d12e.dat --name SRR891268_chr22_enriched --format BED --gsize 2700000000 --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
# ARGUMENTS LIST:
# name = SRR891268_chr22_enriched
# format = BED
# ChIP-seq file = ['/tmp/tmp89xn9jz6/files/6/7/f/dataset_67fdf7ff-a7e9-40be-8906-430d5a80d12e.dat']
# control file = None
# effective genome size = 2.70e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
 
INFO  @ Thu, 14 Mar 2024 13:30:51: #1 read tag files... 
INFO  @ Thu, 14 Mar 2024 13:30:51: #1 read treatment tags... 
INFO  @ Thu, 14 Mar 2024 13:30:51: #1 tag size is determined as 47 bps 
INFO  @ Thu, 14 Mar 2024 13:30:51: #1 tag size = 47.0 
INFO  @ Thu, 14 Mar 2024 13:30:51: #1  total tags in treatment: 232804 
INFO  @ Thu, 14 Mar 2024 13:30:51: #1 finished! 
INFO  @ Thu, 14 Mar 2024 13:30:51: #2 Build Peak Model... 
INFO  @ Thu, 14 Mar 2024 13:30:51: #2 Skipped... 
INFO  @ Thu, 14 Mar 2024 13:30:51: #2 Use 200 as fragment length 
INFO  @ Thu, 14 Mar 2024 13:30:51: #2 Sequencing ends will be shifted towards 5' by 100 bp(s) 
INFO  @ Thu, 14 Mar 2024 13:30:51: #3 Call peaks... 
INFO  @ Thu, 14 Mar 2024 13:30:51: #3 Going to call summits inside each peak ... 
INFO  @ Thu, 14 Mar 2024 13:30:51: #3 Pre-compute pvalue-qvalue table... 
INFO  @ Thu, 14 Mar 2024 13:30:52: #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ Thu, 14 Mar 2024 13:30:52: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... SRR891268_chr22_enriched_treat_pileup.bdg 
INFO  @ Thu, 14 Mar 2024 13:30:52: #3   Write bedGraph files for control lambda (after scaling if necessary)... SRR891268_chr22_enriched_control_lambda.bdg 
INFO  @ Thu, 14 Mar 2024 13:30:52: #3   Pileup will be based on sequencing depth in treatment. 
INFO  @ Thu, 14 Mar 2024 13:30:52: #3 Call peaks for each chromosome... 
INFO  @ Thu, 14 Mar 2024 13:30:53: #4 Write output xls file... SRR891268_chr22_enriched_peaks.xls 
INFO  @ Thu, 14 Mar 2024 13:30:53: #4 Write peak in narrowPeak format file... SRR891268_chr22_enriched_peaks.narrowPeak 
INFO  @ Thu, 14 Mar 2024 13:30:53: #4 Write summits bed file... SRR891268_chr22_enriched_summits.bed 
INFO  @ Thu, 14 Mar 2024 13:30:53: Done!

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
advanced_options	`{"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 2, "keep_dup_options_selector": "all"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": false, "to_large": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
control	`{"__current_case__": 1, "c_select": "No"}`
cutoff_options	`{"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}`
dbkey	`"hg19"`
effective_genome_size_options	`{"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "2700000000"}`
format	`"BED"`
nomodel_type	`{"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "-100"}`
outputs	`["peaks_tabular", "summits", "bdg", "html"]`
treatment	`{"__current_case__": 0, "input_treatment_file": {"values": [{"id": 16, "src": "dce"}]}, "t_multi_select": "No"}`

Step 15: compute 1/million reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmp89xn9jz6/job_working_directory/000/13/configs/tmpczqfy9f8' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp89xn9jz6/files/6/2/7/dataset_6273e353-8840-4e88-b068-0637ff868b41.dat' '/tmp/tmp89xn9jz6/job_working_directory/000/13/outputs/dataset_66734918-ad91-47e5-8dbe-a0793f77b37e.dat'

Exit Code:

```
0
```

Standard Output:

Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
avoid_scientific_notation	`true`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"}`

Step 16: Bigwig from MACS2 (no norm):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -v "^track" '/tmp/tmp89xn9jz6/files/b/8/7/dataset_b87e2297-9338-4ad8-b0e1-68f7e802c3dc.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len' '/tmp/tmp89xn9jz6/job_working_directory/000/14/outputs/dataset_863bc798-a564-4135-83f0-9fb16cd9d8bc.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 17: get summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools slop    -g '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len'  -i '/tmp/tmp89xn9jz6/files/5/d/d/dataset_5ddb2d35-3e87-4f6f-a3e2-63e1d5592e79.dat' -b 500  > '/tmp/tmp89xn9jz6/job_working_directory/000/15/outputs/dataset_2b24838f-ae06-4d82-826d-4d6a97960629.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
addition	`{"__current_case__": 0, "addition_select": "b", "b": "500"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
genome_file_opts	`{"__current_case__": 0, "genome": "hg19", "genome_file_opts_selector": "loc"}`
header	`false`
pct	`false`
strand	`false`

Step 18: summary of MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -P -A 0 -B 0  -i -- '^#' '/tmp/tmp89xn9jz6/files/7/5/6/dataset_756519d3-7da7-4978-a707-072d0619aaef.dat' | grep -v "^--$" > '/tmp/tmp89xn9jz6/job_working_directory/000/16/outputs/dataset_e3bbd861-c950-4d4e-ae50-eec8cb6d5b58.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
case_sensitive	`"-i"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
color	`"NOCOLOR"`
dbkey	`"hg19"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-P"`
url_paste	`"^#"`

Step 19: Convert 1/million reads to parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
param_type	`"text"`
remove_newlines	`true`

Step 20: Isolate each bigwig do normalize not average:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
input	`{"values": [{"id": 23, "src": "hdca"}]}`
rules	{"mapping": [{"collapsible_value": {"__class__": "RuntimeValue"}, "columns": [0, 1], "connectable": true, "editing": false, "is_workflow": false, "type": "list_identifiers"}], "rules": [{"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}]}

Step 3: effective_genome_size:
- step_state: scheduled

Step 21: Merge summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mergeBed -i '/tmp/tmp89xn9jz6/files/2/b/2/dataset_2b24838f-ae06-4d82-826d-4d6a97960629.dat'  -d 0    > '/tmp/tmp89xn9jz6/job_working_directory/000/18/outputs/dataset_c943d68c-71d3-4798-8404-7b031375b6c9.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
c_and_o_argument_repeat	`[]`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
distance	`"0"`
header	`false`
strand	`""`

Step 22: normalize by million reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmp89xn9jz6/files/8/6/3/dataset_863bc798-a564-4135-83f0-9fb16cd9d8bc.dat --outFileName '/tmp/tmp89xn9jz6/job_working_directory/000/27/outputs/dataset_ae735cd4-7579-4926-b058-89d6f418dca1.dat' --outFileFormat 'bigwig'     --scaleFactors '4.295458840913386' --binSize 1000

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
advancedOpt	`{"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "4.295458840913386", "showAdvancedOpt": "yes", "skipNAs": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
outFileFormat	`"bigwig"`
region	`""`

Step 23: Compute coverage on summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools coverage        -a '/tmp/tmp89xn9jz6/files/c/9/4/dataset_c943d68c-71d3-4798-8404-7b031375b6c9.dat' -b '/tmp/tmp89xn9jz6/files/4/e/1/dataset_4e1ae64e-a9b6-4dc7-89e1-5266cd927db3.dat'      | sort -k1,1 -k2,2n > '/tmp/tmp89xn9jz6/job_working_directory/000/19/outputs/dataset_4c50ce0d-8915-48e6-b559-3ee12cc4bd1e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
a_or_b	`false`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
d	`false`
dbkey	`"hg19"`
hist	`false`
mean	`false`
overlap_a	`None`
overlap_b	`None`
reciprocal_overlap	`false`
reduce_or_iterate	`{"__current_case__": 0, "inputB": {"values": [{"id": 14, "src": "dce"}]}, "reduce_or_iterate_selector": "iterate"}`
sorted	`false`
split	`false`
strandedness	`false`

Step 24: number of reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp89xn9jz6/job_working_directory/000/20/configs/tmpjb22doqy' '/tmp/tmp89xn9jz6/files/4/c/5/dataset_4c50ce0d-8915-48e6-b559-3ee12cc4bd1e.dat' > '/tmp/tmp89xn9jz6/job_working_directory/000/20/outputs/dataset_1f03630f-9043-44eb-b2f1-f94049f2ed1c.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	`"{S=S+$4}END{print S}"`
dbkey	`"hg19"`

Step 25: compute 1/million reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmp89xn9jz6/job_working_directory/000/21/configs/tmp8yut0t4e' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp89xn9jz6/files/1/f/0/dataset_1f03630f-9043-44eb-b2f1-f94049f2ed1c.dat' '/tmp/tmp89xn9jz6/job_working_directory/000/21/outputs/dataset_4f0885b2-1bb5-40ec-97ed-6490031ce707.dat'

Exit Code:

```
0
```

Standard Output:

Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
avoid_scientific_notation	`true`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"}`

Step 26: Combine number of reads in peaks with total number of reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmp89xn9jz6/galaxy-dev/tools/filters/catWrapper.py '/tmp/tmp89xn9jz6/job_working_directory/000/22/outputs/dataset_180a2bda-7f3f-48d0-a524-d9b515b09e5f.dat' '/tmp/tmp89xn9jz6/files/1/f/0/dataset_1f03630f-9043-44eb-b2f1-f94049f2ed1c.dat' '/tmp/tmp89xn9jz6/files/6/2/7/dataset_6273e353-8840-4e88-b068-0637ff868b41.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
queries	`[{"__index__": 0, "input2": {"values": [{"id": 19, "src": "dce"}]}}]`

Step 27: Convert 1/million reads in peaks to parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
param_type	`"text"`
remove_newlines	`true`

Step 28: reads in peaks multiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp89xn9jz6/job_working_directory/000/24/configs/tmpzf2vclov' '/tmp/tmp89xn9jz6/files/1/8/0/dataset_180a2bda-7f3f-48d0-a524-d9b515b09e5f.dat' > '/tmp/tmp89xn9jz6/job_working_directory/000/24/outputs/dataset_d44863cc-84da-4c8e-bb02-c466f5538ecd.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	`" NR==1{print \"in peaks\",$1;inp=$1}NR==2{print \"outside peaks\",$1 - inp}"`
dbkey	`"hg19"`

Step 29: normalize by million reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmp89xn9jz6/files/8/6/3/dataset_863bc798-a564-4135-83f0-9fb16cd9d8bc.dat --outFileName '/tmp/tmp89xn9jz6/job_working_directory/000/28/outputs/dataset_35dcd663-1e66-4653-b7fd-e276093ea024.dat' --outFileFormat 'bigwig'     --scaleFactors '114.96895838123707' --binSize 1000

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
advancedOpt	`{"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "114.96895838123707", "showAdvancedOpt": "yes", "skipNAs": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
outFileFormat	`"bigwig"`
region	`""`

Step 30: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&    ln -s '/tmp/tmp89xn9jz6/files/f/8/b/dataset_f8b8b961-b762-4dab-a9a9-89ca6ff49d4b.dat' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" && mkdir multiqc_WDir/bowtie2_1 &&        grep -q '% overall alignment rate' /tmp/tmp89xn9jz6/files/9/c/a/dataset_9ca95c36-5221-4e9a-acb3-39b654e2c614.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmp89xn9jz6/files/9/c/a/dataset_9ca95c36-5221-4e9a-acb3-39b654e2c614.dat' 'multiqc_WDir/bowtie2_1/SRR891268_chr22_enriched'  &&   mkdir multiqc_WDir/custom_content_2 && ln -s '/tmp/tmp89xn9jz6/files/b/b/d/dataset_bbd911ea-d868-46bd-864f-cc4aefb54648.dat' 'multiqc_WDir/custom_content_2/file_2_0' && more /tmp/tmp89xn9jz6/files/b/b/d/dataset_bbd911ea-d868-46bd-864f-cc4aefb54648.dat && mkdir multiqc_WDir/picard_3 &&      mkdir 'multiqc_WDir/picard_3/markdups_0' &&    grep -q 'MarkDuplicates' /tmp/tmp89xn9jz6/files/4/e/5/dataset_4e58ce0a-eeb7-4c6a-a82c-3c8b1e68b770.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmp89xn9jz6/files/4/e/5/dataset_4e58ce0a-eeb7-4c6a-a82c-3c8b1e68b770.dat' 'multiqc_WDir/picard_3/markdups_0/SRR891268_chr22_enriched'  &&    mkdir multiqc_WDir/custom_content_4 && ln -s '/tmp/tmp89xn9jz6/files/e/6/6/dataset_e664b7db-2cac-4cc5-9419-ac95c988e89f.dat' 'multiqc_WDir/custom_content_4/file_4_0' && more /tmp/tmp89xn9jz6/files/e/6/6/dataset_e664b7db-2cac-4cc5-9419-ac95c988e89f.dat && mkdir multiqc_WDir/macs2_5 &&    grep -q "# This file is generated by MACS" /tmp/tmp89xn9jz6/files/7/5/6/dataset_756519d3-7da7-4978-a707-072d0619aaef.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmp89xn9jz6/files/7/5/6/dataset_756519d3-7da7-4978-a707-072d0619aaef.dat' 'multiqc_WDir/macs2_5/SRR891268_chr22_enriched_peaks.xls' && mkdir multiqc_WDir/custom_content_6 && ln -s '/tmp/tmp89xn9jz6/files/d/4/4/dataset_d44863cc-84da-4c8e-bb02-c466f5538ecd.dat' 'multiqc_WDir/custom_content_6/file_6_0' && more /tmp/tmp89xn9jz6/files/d/4/4/dataset_d44863cc-84da-4c8e-bb02-c466f5538ecd.dat &&  multiqc multiqc_WDir --filename 'report'    --export  --config '/tmp/tmp89xn9jz6/job_working_directory/000/25/configs/tmpbuvmy79d'

Exit Code:

```
0
```

Standard Error:

  /// MultiQC 🔍 | v1.11

|           multiqc | MultiQC Version v1.21 now available!
|           multiqc | Search path : /tmp/tmp89xn9jz6/job_working_directory/000/25/working/multiqc_WDir
|    custom_content | Could not parse comment file header for MultiQC custom content: file_4_0
|    custom_content | section_2: Found 1 samples (bargraph)
|    custom_content | section_4: Found 1 samples (linegraph)
|    custom_content | section_6: Found 1 samples (bargraph)
|             macs2 | Found 1 logs
|            picard | Found 1 MarkDuplicates reports
|           bowtie2 | Found 1 reports
|          cutadapt | Found 1 reports
|           multiqc | Compressing plot data
|           multiqc | Report      : report.html
|           multiqc | Data        : report_data
|           multiqc | Plots       : report_plots
|           multiqc | MultiQC complete

Standard Output:

::::::::::::::
/tmp/tmp89xn9jz6/files/b/b/d/dataset_bbd911ea-d868-46bd-864f-cc4aefb54648.dat
::::::::::::::
chrM	216347
others	339454
::::::::::::::
/tmp/tmp89xn9jz6/files/e/6/6/dataset_e664b7db-2cac-4cc5-9419-ac95c988e89f.dat
::::::::::::::
# localbam.bam
# Chromosome_ID	Chromosome_Size	Aligned_Reads
# chr10	135534747	5214.0
# chr11	135006516	5674.0
# chr11_gl000202_random	40103	0.0
# chr12	133851895	5404.0
# chr13	115169878	3794.0
# chr14	107349540	3422.0
# chr15	102531392	2518.0
# chr16	90354753	3218.0
# chr17_ctg5_hap1	1680828	0.0
# chr17	81195210	2880.0
# chr17_gl000203_random	37498	0.0
# chr17_gl000204_random	81310	0.0
# chr17_gl000205_random	174588	42.0
# chr17_gl000206_random	41001	0.0
# chr18	78077248	3012.0
# chr18_gl000207_random	4262	0.0
# chr19	59128983	2580.0
# chr19_gl000208_random	92689	2.0
# chr19_gl000209_random	159169	0.0
# chr1	249250621	9842.0
# chr1_gl000191_random	106433	2.0
# chr1_gl000192_random	547496	4.0
# chr20	63025520	2366.0
# chr21	48129895	1214.0
# chr21_gl000210_random	27682	0.0
# chr22	51304566	116840.0
# chr2	243199373	10050.0
# chr3	198022430	8394.0
# chr4_ctg9_hap1	590426	0.0
# chr4	191154276	8172.0
# chr4_gl000193_random	189789	2.0
# chr4_gl000194_random	191469	4.0
# chr5	180915260	7536.0
# chr6_apd_hap1	4622290	0.0
# chr6_cox_hap2	4795371	2.0
# chr6_dbb_hap3	4610396	0.0
# chr6	171115067	7054.0
# chr6_mann_hap4	4683263	2.0
# chr6_mcf_hap5	4833398	0.0
# chr6_qbl_hap6	4611984	0.0
# chr6_ssto_hap7	4928567	0.0
# chr7	159138663	6548.0
# chr7_gl000195_random	182896	16.0
# chr8	146364022	6326.0
# chr8_gl000196_random	38914	0.0
# chr8_gl000197_random	37175	0.0
# chr9	141213431	4420.0
# chr9_gl000198_random	90085	22.0
# chr9_gl000199_random	169874	2.0
# chr9_gl000200_random	187035	0.0
# chr9_gl000201_random	36148	0.0
# chrM	16571	0.0
# chrUn_gl000211	166566	6.0
# chrUn_gl000212	186858	2.0
# chrUn_gl000213	164239	0.0
# chrUn_gl000214	137718	10.0
# chrUn_gl000215	172545	0.0
# chrUn_gl000216	172294	2.0
# chrUn_gl000217	172149	24.0
# chrUn_gl000218	161147	0.0
# chrUn_gl000219	179198	10.0
# chrUn_gl000220	161802	236.0
# chrUn_gl000221	155397	2.0
# chrUn_gl000222	186861	0.0
# chrUn_gl000223	180455	0.0
# chrUn_gl000224	179693	8.0
# chrUn_gl000225	211173	8.0
# chrUn_gl000226	15008	6.0
# chrUn_gl000227	128374	0.0
# chrUn_gl000228	129120	0.0
# chrUn_gl000229	19913	82.0
# chrUn_gl000230	43691	8.0
# chrUn_gl000231	27386	84.0
# chrUn_gl000232	40652	158.0
# chrUn_gl000233	45941	32.0
# chrUn_gl000234	40531	122.0
# chrUn_gl000235	34474	50.0
# chrUn_gl000236	41934	0.0
# chrUn_gl000237	45867	66.0
# chrUn_gl000238	39939	2.0
# chrUn_gl000239	33824	2.0
# chrUn_gl000240	41933	12.0
# chrUn_gl000241	42152	118.0
# chrUn_gl000242	43523	10.0
# chrUn_gl000243	43341	12.0
# chrUn_gl000244	39929	0.0
# chrUn_gl000245	36651	2.0
# chrUn_gl000246	38154	6.0
# chrUn_gl000247	36422	0.0
# chrUn_gl000248	39786	6.0
# chrUn_gl000249	38502	0.0
# chrX	155270560	5134.0
# chrY	59373566	6.0
# Total Genome Size: 3.137161264E9	Total Aligned Tags: 232804.0
# bowtie2	# 2.5.3
# "/usr/local/bin/bowtie2-align-s --wrapper basic-0 -p 1 -x /cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full --very-sensitive -1 input_f.fastq -2 input_r.fastq"
# MarkDuplicates	# Version:3.1.1
# MarkDuplicates --TAGGING_POLICY All --INPUT SRR891268_chr22_enriched --OUTPUT /tmp/tmp89xn9jz6/job_working_directory/000/7/outputs/dataset_4e1ae64e-a9b6-4dc7-89e1-5266cd927db3.dat --METRICS_FILE /tmp/tmp89xn9jz6/job_working_directory/000/7/outputs/dataset_4e58ce0a-eeb7-4c6a-a82c-3c8b1e68b770.dat --REMOVE_DUPLICATES true --ASSUME_SORTED true --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --VERBOSITY ERROR --QUIET true --VALIDATION_STRINGENCY LENIENT --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX <optimized capture of last three ':' separated fields as numeric values> --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false
# Average Insert Size: 162.46371196371197
# Median Insert Size: 126.0
# Std deviation of Insert Size: 117.9037267671474
# Number of ReadPairs: 116402.0
# Histogram
# Size (bp)	Frequency
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.0
20	0.0
21	0.0
22	0.0
23	1.0
24	1.0
25	11.0
26	142.0
27	117.0
28	131.0
29	130.0
30	90.0
31	88.0
32	101.0
33	116.0
34	199.0
35	385.0
36	613.0
37	761.0
38	827.0
39	1076.0
40	1305.0
41	1453.0
42	1503.0
43	1415.0
44	1214.0
45	1206.0
46	1057.0
47	969.0
48	14.0
49	19.0
50	1190.0
51	1450.0
52	1335.0
53	1142.0
54	1041.0
55	1022.0
56	934.0
57	779.0
58	759.0
59	711.0
60	711.0
61	880.0
62	926.0
63	835.0
64	905.0
65	885.0
66	765.0
67	697.0
68	651.0
69	598.0
70	638.0
71	717.0
72	749.0
73	770.0
74	736.0
75	677.0
76	653.0
77	578.0
78	569.0
79	530.0
80	508.0
81	594.0
82	631.0
83	584.0
84	605.0
85	579.0
86	593.0
87	544.0
88	487.0
89	439.0
90	395.0
91	420.0
92	469.0
93	512.0
94	484.0
95	502.0
96	473.0
97	431.0
98	380.0
99	348.0
100	350.0
101	380.0
102	343.0
103	371.0
104	420.0
105	410.0
106	414.0
107	364.0
108	363.0
109	301.0
110	281.0
111	314.0
112	306.0
113	337.0
114	331.0
115	321.0
116	329.0
117	352.0
118	293.0
119	276.0
120	261.0
121	261.0
122	254.0
123	266.0
124	250.0
125	263.0
126	294.0
127	265.0
128	256.0
129	261.0
130	250.0
131	234.0
132	209.0
133	245.0
134	253.0
135	238.0
136	272.0
137	304.0
138	288.0
139	287.0
140	248.0
141	238.0
142	225.0
143	193.0
144	221.0
145	219.0
146	226.0
147	266.0
148	238.0
149	240.0
150	268.0
151	267.0
152	255.0
153	258.0
154	212.0
155	221.0
156	229.0
157	249.0
158	256.0
159	267.0
160	228.0
161	239.0
162	255.0
163	221.0
164	232.0
165	300.0
166	330.0
167	387.0
168	371.0
169	345.0
170	288.0
171	299.0
172	251.0
173	251.0
174	303.0
175	353.0
176	370.0
177	383.0
178	421.0
179	351.0
180	289.0
181	321.0
182	270.0
183	270.0
184	322.0
185	315.0
186	324.0
187	339.0
188	348.0
189	334.0
190	305.0
191	309.0
192	291.0
193	303.0
194	323.0
195	374.0
196	348.0
197	343.0
198	306.0
199	317.0
200	308.0
201	314.0
202	307.0
203	340.0
204	349.0
205	336.0
206	340.0
207	342.0
208	314.0
209	287.0
210	330.0
211	340.0
212	297.0
213	318.0
214	272.0
215	321.0
216	336.0
217	324.0
218	347.0
219	297.0
220	314.0
221	285.0
222	286.0
223	270.0
224	305.0
225	307.0
226	287.0
227	283.0
228	289.0
229	256.0
230	284.0
231	275.0
232	265.0
233	250.0
234	256.0
235	239.0
236	226.0
237	237.0
238	225.0
239	232.0
240	214.0
241	221.0
242	235.0
243	211.0
244	170.0
245	202.0
246	218.0
247	214.0
248	178.0
249	158.0
250	185.0
251	175.0
252	158.0
253	181.0
254	192.0
255	172.0
256	143.0
257	140.0
258	156.0
259	159.0
260	143.0
261	126.0
262	160.0
263	126.0
264	128.0
265	132.0
266	139.0
267	109.0
268	134.0
269	110.0
270	122.0
271	116.0
272	126.0
273	96.0
274	120.0
275	119.0
276	123.0
277	120.0
278	125.0
279	95.0
280	99.0
281	124.0
282	113.0
283	121.0
284	113.0
285	79.0
286	88.0
287	89.0
288	105.0
289	105.0
290	101.0
291	82.0
292	100.0
293	104.0
294	97.0
295	102.0
296	95.0
297	102.0
298	96.0
299	98.0
300	98.0
301	109.0
302	115.0
303	96.0
304	85.0
305	75.0
306	84.0
307	94.0
308	119.0
309	81.0
310	98.0
311	94.0
312	101.0
313	95.0
314	87.0
315	93.0
316	102.0
317	77.0
318	91.0
319	104.0
320	100.0
321	92.0
322	82.0
323	76.0
324	82.0
325	106.0
326	101.0
327	92.0
328	83.0
329	86.0
330	91.0
331	98.0
332	78.0
333	79.0
334	98.0
335	79.0
336	93.0
337	92.0
338	94.0
339	88.0
340	77.0
341	95.0
342	89.0
343	112.0
344	90.0
345	119.0
346	106.0
347	108.0
348	113.0
349	77.0
350	95.0
351	95.0
352	96.0
353	99.0
354	97.0
355	118.0
356	92.0
357	101.0
358	99.0
359	90.0
360	103.0
361	103.0
362	109.0
363	119.0
364	117.0
365	105.0
366	123.0
367	115.0
368	121.0
369	123.0
370	112.0
371	121.0
372	115.0
373	94.0
374	116.0
375	113.0
376	106.0
377	112.0
378	103.0
379	113.0
380	104.0
381	105.0
382	114.0
383	109.0
384	110.0
385	107.0
386	110.0
387	113.0
388	115.0
389	128.0
390	130.0
391	112.0
392	128.0
393	95.0
394	119.0
395	111.0
396	109.0
397	111.0
398	115.0
399	103.0
400	106.0
401	113.0
402	107.0
403	118.0
404	103.0
405	93.0
406	111.0
407	113.0
408	130.0
409	106.0
410	102.0
411	97.0
412	92.0
413	112.0
414	101.0
415	96.0
416	93.0
417	89.0
418	102.0
419	96.0
420	98.0
421	108.0
422	92.0
423	95.0
424	80.0
425	76.0
426	103.0
427	90.0
428	80.0
429	82.0
430	94.0
431	93.0
432	84.0
433	77.0
434	91.0
435	90.0
436	72.0
437	78.0
438	71.0
439	66.0
440	77.0
441	80.0
442	78.0
443	68.0
444	63.0
445	71.0
446	70.0
447	78.0
448	56.0
449	61.0
450	59.0
451	60.0
452	49.0
453	59.0
454	65.0
455	73.0
456	56.0
457	50.0
458	72.0
459	52.0
460	60.0
461	67.0
462	57.0
463	61.0
464	53.0
465	50.0
466	52.0
467	58.0
468	44.0
469	64.0
470	52.0
471	57.0
472	47.0
473	63.0
474	48.0
475	53.0
476	57.0
477	41.0
478	49.0
479	50.0
480	60.0
481	46.0
482	42.0
483	51.0
484	47.0
485	35.0
486	40.0
487	41.0
488	51.0
489	44.0
490	36.0
491	37.0
492	48.0
493	52.0
494	49.0
495	52.0
496	56.0
497	50.0
498	42.0
499	49.0
500	46.0
::::::::::::::
/tmp/tmp89xn9jz6/files/d/4/4/dataset_d44863cc-84da-4c8e-bb02-c466f5538ecd.dat
::::::::::::::
in peaks	8698
outside peaks	224106
|         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 8/8

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
comment	`""`
dbkey	`"hg19"`
export	`true`
flat	`false`
results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 11, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "chrM", "software": "custom_content", "title": "reads mapping on chrM", "xlab": "", "ylab": ""}}, {"__index__": 3, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 9, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}, {"__index__": 4, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 14, "src": "hdca"}]}, "plot_type": "linegraph", "section_name": "Fragment size", "software": "custom_content", "title": "Fragment size distribution", "xlab": "", "ylab": ""}}, {"__index__": 5, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 16, "src": "hdca"}]}, "software": "macs2"}}, {"__index__": 6, "software_cond": {"__current_case__": 32, "description": "Number of reads falling 500bp from a summit", "input": {"values": [{"id": 33, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "Reads in peaks", "software": "custom_content", "title": "Number of reads in peaks", "xlab": "", "ylab": ""}}]
saveLog	`false`
title	`""`

Step 4: bin_size:
- step_state: scheduled

Step 5: Cutadapt (remove adapter + bad quality bases):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmp89xn9jz6/files/d/3/6/dataset_d36845e8-ec2e-4ff9-806b-e66155299a13.dat' 'SRR891268_chr22_enriched_1.fq' &&  ln -f -s '/tmp/tmp89xn9jz6/files/9/3/b/dataset_93b9a842-18b6-409b-a1eb-d712273092be.dat' 'SRR891268_chr22_enriched_2.fq' &&    cutadapt  -j=${GALAXY_SLOTS:-4}       -a 'Nextera R1'='CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'             -A 'Nextera R2'='CTGTCTCTTATACACATCTGACGCTGCCGACGA'       --output='out1.fq' --paired-output='out2.fq'  --error-rate=0.1 --times=1 --overlap=3    --action=trim      --minimum-length=15 --pair-filter=any    --quality-cutoff=30      'SRR891268_chr22_enriched_1.fq' 'SRR891268_chr22_enriched_2.fq'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}`
chromInfo	`"/tmp/tmp89xn9jz6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_cassava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "minimum_length": "15", "pair_filter": "any"}`
library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTCCGAGCCCACGAGAC", "adapter_name": "Nextera R1", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTGACGCTGCCGACGA", "adapter_name": "Nextera R2", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters2": [], "cut2": "0", "front_adapters2": [], "maximum_length2": null, "minimum_length2": null, "quality_cutoff2": ""}, "type": "paired_collection"}
output_selector	`["report"]`
read_mod_options	`{"cut": "0", "length_tag": "", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "rename": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "strip_suffix": "", "trim_n": false, "zero_cap": false}`

Step 6: Bowtie2 map on reference:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmp89xn9jz6/files/7/3/b/dataset_73b2904e-3deb-4d54-b1da-7fa7f5269393.dat' input_f.fastq &&  ln -f -s '/tmp/tmp89xn9jz6/files/3/4/2/dataset_342115cc-606b-42d4-aba4-4eef3a0e8552.dat' input_r.fastq &&    bowtie2  -p ${GALAXY_SLOTS:-4}  -x '/cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full'   -1 'input_f.fastq' -2 'input_r.fastq'              --very-sensitive   2> '/tmp/tmp89xn9jz6/job_working_directory/000/4/outputs/dataset_9ca95c36-5221-4e9a-acb3-39b654e2c614.dat'  | samtools sort --no-PG -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp89xn9jz6/job_working_directory/000/4/outputs/dataset_fbeb8166-d5e0-4a32-a91e-41f3dd8d8303.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}`
chromInfo	`"/tmp/tmp89xn9jz6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 2, "aligned_file": false, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "paired_options": {"__current_case__": 1, "paired_options_selector": "no"}, "type": "paired_collection", "unaligned_file": false}`
reference_genome	`{"__current_case__": 0, "index": "hg19", "source": "indexed"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 7: filter MAPQ30 concordant pairs and not mitochondrial pairs:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmp89xn9jz6/job_working_directory/000/5/configs/tmplmcom6b9' '/tmp/tmp89xn9jz6/job_working_directory/000/5/outputs/dataset_4da7a57b-d400-47e6-accf-dae07317f1f7.dat' && ln -s '/tmp/tmp89xn9jz6/files/f/b/e/dataset_fbeb8166-d5e0-4a32-a91e-41f3dd8d8303.dat' localbam.bam && ln -s '/tmp/tmp89xn9jz6/files/_metadata_files/e/9/1/metadata_e9151b8b-7f80-4d61-b43a-c412a8ac9878.dat' localbam.bam.bai && cat '/tmp/tmp89xn9jz6/job_working_directory/000/5/configs/tmplmcom6b9' && bamtools filter -script '/tmp/tmp89xn9jz6/job_working_directory/000/5/configs/tmplmcom6b9' -in localbam.bam -out '/tmp/tmp89xn9jz6/job_working_directory/000/5/outputs/dataset_afd88063-a34a-46cb-baca-0cf11dcf9779.dat'

Exit Code:

```
0
```

Standard Output:

        
{
    "filters": [
        {
            "id": "1",
            "mapQuality": ">=30",
            "isProperPair": "true",
            "reference": "!chrM",
            "mateReference": "!MT"
        }
    ]
}

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
conditions	[{"__index__": 0, "filters": [{"__index__": 0, "bam_property": {"__current_case__": 14, "bam_property_selector": "mapQuality", "bam_property_value": ">=30"}}, {"__index__": 1, "bam_property": {"__current_case__": 11, "bam_property_selector": "isProperPair", "bam_property_value": true}}, {"__index__": 2, "bam_property": {"__current_case__": 20, "bam_property_selector": "reference", "bam_property_value": "!chrM"}}, {"__index__": 3, "bam_property": {"__current_case__": 16, "bam_property_selector": "mateReference", "bam_property_value": "!MT"}}]}]
dbkey	`"hg19"`
rule_configuration	`{"__current_case__": 0, "rules_selector": false}`

Step 8: Get number of reads per chromosome:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmp89xn9jz6/files/f/b/e/dataset_fbeb8166-d5e0-4a32-a91e-41f3dd8d8303.dat' infile && ln -s '/tmp/tmp89xn9jz6/files/_metadata_files/e/9/1/metadata_e9151b8b-7f80-4d61-b43a-c412a8ac9878.dat' infile.bai &&  samtools idxstats -@ $addthreads infile  > '/tmp/tmp89xn9jz6/job_working_directory/000/6/outputs/dataset_2b6023d4-ebff-46d1-af45-5378472145b5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`

Step 9: remove PCR duplicates:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

_JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS &&   ln -sf '/tmp/tmp89xn9jz6/files/a/f/d/dataset_afd88063-a34a-46cb-baca-0cf11dcf9779.dat' 'SRR891268_chr22_enriched' &&  picard MarkDuplicates  --INPUT 'SRR891268_chr22_enriched' --OUTPUT '/tmp/tmp89xn9jz6/job_working_directory/000/7/outputs/dataset_4e1ae64e-a9b6-4dc7-89e1-5266cd927db3.dat'  --METRICS_FILE '/tmp/tmp89xn9jz6/job_working_directory/000/7/outputs/dataset_4e58ce0a-eeb7-4c6a-a82c-3c8b1e68b770.dat'  --REMOVE_DUPLICATES 'true' --ASSUME_SORTED 'true'  --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES  --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100'   --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR

Exit Code:

```
0
```

Standard Error:

/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmp89xn9jz6/tmp
Mar 14, 2024 1:30:03 PM com.intel.gkl.NativeLibraryLoader load
INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
comments	`[]`
dbkey	`"hg19"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`true`
validation_stringency	`"LENIENT"`

Step 10: reads in chrM/MT for multiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp89xn9jz6/job_working_directory/000/8/configs/tmp5wu58k8r' '/tmp/tmp89xn9jz6/files/2/b/6/dataset_2b6023d4-ebff-46d1-af45-5378472145b5.dat' > '/tmp/tmp89xn9jz6/job_working_directory/000/8/outputs/dataset_bbd911ea-d868-46bd-864f-cc4aefb54648.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"db069fcee20511eeac2b65a49eaf6d71"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	` " ($1=="chrM"
dbkey	`"hg19"`

Other invocation details
- history_id
  - f4e30e2de395aa7a
- history_state
  - ok
- invocation_id
  - f4e30e2de395aa7a
- invocation_state
  - scheduled
- workflow_id
  - f4e30e2de395aa7a

github-actions · 2024-03-14T14:21:54Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ atacseq.ga_0

Problems:

Output with path /tmp/tmp1ba2oq39/picard_dups__6b791ad0-e13b-4a78-bef1-fe8c645d9661 different than expected
Expected line 'SRR891268_chr22_enriched	Unknown Library	0.0	120653.0	0.0	0.0	0.0	3437.0	5.0	0.028487	2080211.0' in output ('Sample	LIBRARY	UNPAIRED_READS_EXAMINED	READ_PAIRS_EXAMINED	SECONDARY_OR_SUPPLEMENTARY_RDS	UNMAPPED_READS	UNPAIRED_READ_DUPLICATES	READ_PAIR_DUPLICATES	READ_PAIR_OPTICAL_DUPLICATES	PERCENT_DUPLICATION	ESTIMATED_LIBRARY_SIZE
SRR891268_chr22_enriched	Unknown Library	0.0	119813.0	0.0	0.0	0.0	3411.0	5.0	0.028469	2067029.0
')

Workflow invocation details

Invocation Messages

Steps

Step 1: PE fastq input:
- step_state: scheduled
Step 2: reference_genome:
- step_state: scheduled

Step 11: convert BAM to BED to improve peak calling:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp1c8vk83u/files/1/4/3/dataset_1439013d-363a-4ed3-9de6-dc1ad50d7afb.dat' ./input.bam &&  bedtools bamtobed    -i ./input.bam > '/tmp/tmp1c8vk83u/job_working_directory/000/9/outputs/dataset_9c74e81d-288d-4942-8e77-02508f98f62f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
ed_score	`false`
option	`""`
split	`false`
tag	`""`

Step 12: Compute fragment length histogram:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp1c8vk83u/files/1/4/3/dataset_1439013d-363a-4ed3-9de6-dc1ad50d7afb.dat' localbam.bam && ln -f -s '/tmp/tmp1c8vk83u/files/_metadata_files/a/0/5/metadata_a05ca91f-09d5-482a-aed1-7ad147675a1d.dat' localbam.bam.bai && java -jar '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/pe_histogram/bd1416eea1f0/pe_histogram/PEHistogram.jar' -B localbam.bam -I localbam.bam.bai -u 500 -p '/tmp/tmp1c8vk83u/job_working_directory/000/10/outputs/dataset_76068adc-6802-4ed6-994c-87a0b48c7029.dat' -t '/tmp/tmp1c8vk83u/job_working_directory/000/10/outputs/dataset_f604c8a0-e1a7-43cd-b9a5-709557faa060.dat' 1>/dev/null

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
lower_limit	`None`
upper_limit	`"500"`

Step 13: number of reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp1c8vk83u/files/1/4/3/dataset_1439013d-363a-4ed3-9de6-dc1ad50d7afb.dat' infile && ln -s '/tmp/tmp1c8vk83u/files/_metadata_files/a/0/5/metadata_a05ca91f-09d5-482a-aed1-7ad147675a1d.dat' infile.bai &&        samtools view -@ $addthreads -c     -o outfile     infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
mode	`{"__current_case__": 0, "output_options": {"__current_case__": 1, "reads_report_type": "count"}, "outtype": "all_reads"}`

Step 14: Call Peak with MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmp1c8vk83u/files/9/c/7/dataset_9c74e81d-288d-4942-8e77-02508f98f62f.dat'  --name SRR891268_chr22_enriched    --format BED   --gsize '2700000000'           --call-summits  --keep-dup 'all'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '-100'  2>&1 > macs2_stderr) && cp SRR891268_chr22_enriched_peaks.xls '/tmp/tmp1c8vk83u/job_working_directory/000/12/outputs/dataset_b2aeb9ae-d4b7-4788-b644-c0eb9791838c.dat'   && ( count=`ls -1 SRR891268_chr22_enriched* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmp1c8vk83u/job_working_directory/000/12/outputs/dataset_2b12987f-cce4-4d98-a0d2-4536e9f67c81_files' && cp -r SRR891268_chr22_enriched* '/tmp/tmp1c8vk83u/job_working_directory/000/12/outputs/dataset_2b12987f-cce4-4d98-a0d2-4536e9f67c81_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmp1c8vk83u/job_working_directory/000/12/outputs/dataset_2b12987f-cce4-4d98-a0d2-4536e9f67c81_files' macs2_stderr > '/tmp/tmp1c8vk83u/job_working_directory/000/12/outputs/dataset_2b12987f-cce4-4d98-a0d2-4536e9f67c81.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

Exit Code:

```
0
```

Standard Output:

INFO  @ Thu, 14 Mar 2024 14:13:16: 
# Command line: callpeak -t /tmp/tmp1c8vk83u/files/9/c/7/dataset_9c74e81d-288d-4942-8e77-02508f98f62f.dat --name SRR891268_chr22_enriched --format BED --gsize 2700000000 --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
# ARGUMENTS LIST:
# name = SRR891268_chr22_enriched
# format = BED
# ChIP-seq file = ['/tmp/tmp1c8vk83u/files/9/c/7/dataset_9c74e81d-288d-4942-8e77-02508f98f62f.dat']
# control file = None
# effective genome size = 2.70e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
 
INFO  @ Thu, 14 Mar 2024 14:13:16: #1 read tag files... 
INFO  @ Thu, 14 Mar 2024 14:13:16: #1 read treatment tags... 
INFO  @ Thu, 14 Mar 2024 14:13:16: #1 tag size is determined as 47 bps 
INFO  @ Thu, 14 Mar 2024 14:13:16: #1 tag size = 47.0 
INFO  @ Thu, 14 Mar 2024 14:13:16: #1  total tags in treatment: 232804 
INFO  @ Thu, 14 Mar 2024 14:13:16: #1 finished! 
INFO  @ Thu, 14 Mar 2024 14:13:16: #2 Build Peak Model... 
INFO  @ Thu, 14 Mar 2024 14:13:16: #2 Skipped... 
INFO  @ Thu, 14 Mar 2024 14:13:16: #2 Use 200 as fragment length 
INFO  @ Thu, 14 Mar 2024 14:13:16: #2 Sequencing ends will be shifted towards 5' by 100 bp(s) 
INFO  @ Thu, 14 Mar 2024 14:13:16: #3 Call peaks... 
INFO  @ Thu, 14 Mar 2024 14:13:16: #3 Going to call summits inside each peak ... 
INFO  @ Thu, 14 Mar 2024 14:13:16: #3 Pre-compute pvalue-qvalue table... 
INFO  @ Thu, 14 Mar 2024 14:13:16: #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ Thu, 14 Mar 2024 14:13:16: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... SRR891268_chr22_enriched_treat_pileup.bdg 
INFO  @ Thu, 14 Mar 2024 14:13:16: #3   Write bedGraph files for control lambda (after scaling if necessary)... SRR891268_chr22_enriched_control_lambda.bdg 
INFO  @ Thu, 14 Mar 2024 14:13:16: #3   Pileup will be based on sequencing depth in treatment. 
INFO  @ Thu, 14 Mar 2024 14:13:16: #3 Call peaks for each chromosome... 
INFO  @ Thu, 14 Mar 2024 14:13:17: #4 Write output xls file... SRR891268_chr22_enriched_peaks.xls 
INFO  @ Thu, 14 Mar 2024 14:13:17: #4 Write peak in narrowPeak format file... SRR891268_chr22_enriched_peaks.narrowPeak 
INFO  @ Thu, 14 Mar 2024 14:13:17: #4 Write summits bed file... SRR891268_chr22_enriched_summits.bed 
INFO  @ Thu, 14 Mar 2024 14:13:17: Done!

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
advanced_options	`{"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 2, "keep_dup_options_selector": "all"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": false, "to_large": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
control	`{"__current_case__": 1, "c_select": "No"}`
cutoff_options	`{"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}`
dbkey	`"hg19"`
effective_genome_size_options	`{"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "2700000000"}`
format	`"BED"`
nomodel_type	`{"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "-100"}`
outputs	`["peaks_tabular", "summits", "bdg", "html"]`
treatment	`{"__current_case__": 0, "input_treatment_file": {"values": [{"id": 16, "src": "dce"}]}, "t_multi_select": "No"}`

Step 15: compute 1/million reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmp1c8vk83u/job_working_directory/000/13/configs/tmphjj7e259' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp1c8vk83u/files/8/0/9/dataset_809bce43-d257-479f-88f6-42b831093841.dat' '/tmp/tmp1c8vk83u/job_working_directory/000/13/outputs/dataset_e3fc2fa1-1197-471c-ba83-328b235fd2a9.dat'

Exit Code:

```
0
```

Standard Output:

Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
avoid_scientific_notation	`true`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"}`

Step 16: Bigwig from MACS2 (no norm):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -v "^track" '/tmp/tmp1c8vk83u/files/5/a/2/dataset_5a2dd565-089a-4e31-8cdf-7ae02f265023.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len' '/tmp/tmp1c8vk83u/job_working_directory/000/14/outputs/dataset_a47e029c-9049-4cbb-8e30-3007529f4a80.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 17: get summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools slop    -g '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len'  -i '/tmp/tmp1c8vk83u/files/0/b/0/dataset_0b08ba2d-083e-426f-b2c5-37b1ac0323b7.dat' -b 500  > '/tmp/tmp1c8vk83u/job_working_directory/000/15/outputs/dataset_0fed6eec-4daa-4ae1-bf52-93d01958cd53.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
addition	`{"__current_case__": 0, "addition_select": "b", "b": "500"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
genome_file_opts	`{"__current_case__": 0, "genome": "hg19", "genome_file_opts_selector": "loc"}`
header	`false`
pct	`false`
strand	`false`

Step 18: summary of MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -P -A 0 -B 0  -i -- '^#' '/tmp/tmp1c8vk83u/files/b/2/a/dataset_b2aeb9ae-d4b7-4788-b644-c0eb9791838c.dat' | grep -v "^--$" > '/tmp/tmp1c8vk83u/job_working_directory/000/16/outputs/dataset_a0f9272f-50ae-412f-a451-e43e3ce3b0ae.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
case_sensitive	`"-i"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
color	`"NOCOLOR"`
dbkey	`"hg19"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-P"`
url_paste	`"^#"`

Step 19: Convert 1/million reads to parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
param_type	`"text"`
remove_newlines	`true`

Step 20: Isolate each bigwig do normalize not average:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
input	`{"values": [{"id": 23, "src": "hdca"}]}`
rules	{"mapping": [{"collapsible_value": {"__class__": "RuntimeValue"}, "columns": [0, 1], "connectable": true, "editing": false, "is_workflow": false, "type": "list_identifiers"}], "rules": [{"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}]}

Step 3: effective_genome_size:
- step_state: scheduled

Step 21: Merge summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mergeBed -i '/tmp/tmp1c8vk83u/files/0/f/e/dataset_0fed6eec-4daa-4ae1-bf52-93d01958cd53.dat'  -d 0    > '/tmp/tmp1c8vk83u/job_working_directory/000/18/outputs/dataset_6d16d8cd-d506-497c-ba13-d2b8d09b8c8e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
c_and_o_argument_repeat	`[]`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
distance	`"0"`
header	`false`
strand	`""`

Step 22: normalize by million reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmp1c8vk83u/files/a/4/7/dataset_a47e029c-9049-4cbb-8e30-3007529f4a80.dat --outFileName '/tmp/tmp1c8vk83u/job_working_directory/000/27/outputs/dataset_e27e17c6-885e-4603-9853-416c46fc5618.dat' --outFileFormat 'bigwig'     --scaleFactors '4.295458840913386' --binSize 1000

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
advancedOpt	`{"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "4.295458840913386", "showAdvancedOpt": "yes", "skipNAs": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
outFileFormat	`"bigwig"`
region	`""`

Step 23: Compute coverage on summits +/-500kb:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools coverage        -a '/tmp/tmp1c8vk83u/files/6/d/1/dataset_6d16d8cd-d506-497c-ba13-d2b8d09b8c8e.dat' -b '/tmp/tmp1c8vk83u/files/1/4/3/dataset_1439013d-363a-4ed3-9de6-dc1ad50d7afb.dat'      | sort -k1,1 -k2,2n > '/tmp/tmp1c8vk83u/job_working_directory/000/19/outputs/dataset_3f5ee56d-4f65-415e-bf91-27662d13bcd9.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
a_or_b	`false`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
d	`false`
dbkey	`"hg19"`
hist	`false`
mean	`false`
overlap_a	`None`
overlap_b	`None`
reciprocal_overlap	`false`
reduce_or_iterate	`{"__current_case__": 0, "inputB": {"values": [{"id": 14, "src": "dce"}]}, "reduce_or_iterate_selector": "iterate"}`
sorted	`false`
split	`false`
strandedness	`false`

Step 24: number of reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp1c8vk83u/job_working_directory/000/20/configs/tmp48a1diss' '/tmp/tmp1c8vk83u/files/3/f/5/dataset_3f5ee56d-4f65-415e-bf91-27662d13bcd9.dat' > '/tmp/tmp1c8vk83u/job_working_directory/000/20/outputs/dataset_0f396b4f-18f3-43b4-b10b-d07858fb66d0.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	`"{S=S+$4}END{print S}"`
dbkey	`"hg19"`

Step 25: compute 1/million reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmp1c8vk83u/job_working_directory/000/21/configs/tmp8cel3sq3' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp1c8vk83u/files/0/f/3/dataset_0f396b4f-18f3-43b4-b10b-d07858fb66d0.dat' '/tmp/tmp1c8vk83u/job_working_directory/000/21/outputs/dataset_18e1cc26-b6dd-4736-847f-beabed62cf54.dat'

Exit Code:

```
0
```

Standard Output:

Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
avoid_scientific_notation	`true`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"}`

Step 26: Combine number of reads in peaks with total number of reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmp1c8vk83u/galaxy-dev/tools/filters/catWrapper.py '/tmp/tmp1c8vk83u/job_working_directory/000/22/outputs/dataset_f2636e76-c279-44ef-b4e5-a24f66709859.dat' '/tmp/tmp1c8vk83u/files/0/f/3/dataset_0f396b4f-18f3-43b4-b10b-d07858fb66d0.dat' '/tmp/tmp1c8vk83u/files/8/0/9/dataset_809bce43-d257-479f-88f6-42b831093841.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
queries	`[{"__index__": 0, "input2": {"values": [{"id": 19, "src": "dce"}]}}]`

Step 27: Convert 1/million reads in peaks to parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
param_type	`"text"`
remove_newlines	`true`

Step 28: reads in peaks multiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp1c8vk83u/job_working_directory/000/24/configs/tmpt8e8t_99' '/tmp/tmp1c8vk83u/files/f/2/6/dataset_f2636e76-c279-44ef-b4e5-a24f66709859.dat' > '/tmp/tmp1c8vk83u/job_working_directory/000/24/outputs/dataset_1246ef9e-c5d4-4679-b133-ba3812781712.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	`" NR==1{print \"in peaks\",$1;inp=$1}NR==2{print \"outside peaks\",$1 - inp}"`
dbkey	`"hg19"`

Step 29: normalize by million reads in peaks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmp1c8vk83u/files/a/4/7/dataset_a47e029c-9049-4cbb-8e30-3007529f4a80.dat --outFileName '/tmp/tmp1c8vk83u/job_working_directory/000/28/outputs/dataset_4e1af6c3-2cdd-4786-8316-afe13908129d.dat' --outFileFormat 'bigwig'     --scaleFactors '114.96895838123707' --binSize 1000

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
advancedOpt	`{"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "114.96895838123707", "showAdvancedOpt": "yes", "skipNAs": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`
outFileFormat	`"bigwig"`
region	`""`

Step 30: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&    ln -s '/tmp/tmp1c8vk83u/files/9/a/8/dataset_9a8841bd-ed86-4300-90f5-63c2942ca56a.dat' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" && mkdir multiqc_WDir/bowtie2_1 &&        grep -q '% overall alignment rate' /tmp/tmp1c8vk83u/files/4/7/e/dataset_47e2760e-a9d4-433d-b463-bbb91ae4f7ba.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmp1c8vk83u/files/4/7/e/dataset_47e2760e-a9d4-433d-b463-bbb91ae4f7ba.dat' 'multiqc_WDir/bowtie2_1/SRR891268_chr22_enriched'  &&   mkdir multiqc_WDir/custom_content_2 && ln -s '/tmp/tmp1c8vk83u/files/7/2/4/dataset_7248a425-1b21-4a9e-9cdb-5b99bcc99568.dat' 'multiqc_WDir/custom_content_2/file_2_0' && more /tmp/tmp1c8vk83u/files/7/2/4/dataset_7248a425-1b21-4a9e-9cdb-5b99bcc99568.dat && mkdir multiqc_WDir/picard_3 &&      mkdir 'multiqc_WDir/picard_3/markdups_0' &&    grep -q 'MarkDuplicates' /tmp/tmp1c8vk83u/files/9/f/6/dataset_9f6e1a4a-9462-4863-acc4-55efbab5260b.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmp1c8vk83u/files/9/f/6/dataset_9f6e1a4a-9462-4863-acc4-55efbab5260b.dat' 'multiqc_WDir/picard_3/markdups_0/SRR891268_chr22_enriched'  &&    mkdir multiqc_WDir/custom_content_4 && ln -s '/tmp/tmp1c8vk83u/files/f/6/0/dataset_f604c8a0-e1a7-43cd-b9a5-709557faa060.dat' 'multiqc_WDir/custom_content_4/file_4_0' && more /tmp/tmp1c8vk83u/files/f/6/0/dataset_f604c8a0-e1a7-43cd-b9a5-709557faa060.dat && mkdir multiqc_WDir/macs2_5 &&    grep -q "# This file is generated by MACS" /tmp/tmp1c8vk83u/files/b/2/a/dataset_b2aeb9ae-d4b7-4788-b644-c0eb9791838c.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmp1c8vk83u/files/b/2/a/dataset_b2aeb9ae-d4b7-4788-b644-c0eb9791838c.dat' 'multiqc_WDir/macs2_5/SRR891268_chr22_enriched_peaks.xls' && mkdir multiqc_WDir/custom_content_6 && ln -s '/tmp/tmp1c8vk83u/files/1/2/4/dataset_1246ef9e-c5d4-4679-b133-ba3812781712.dat' 'multiqc_WDir/custom_content_6/file_6_0' && more /tmp/tmp1c8vk83u/files/1/2/4/dataset_1246ef9e-c5d4-4679-b133-ba3812781712.dat &&  multiqc multiqc_WDir --filename 'report'    --export  --config '/tmp/tmp1c8vk83u/job_working_directory/000/25/configs/tmpsnwmla42'

Exit Code:

```
0
```

Standard Error:

  /// MultiQC 🔍 | v1.11

|           multiqc | MultiQC Version v1.21 now available!
|           multiqc | Search path : /tmp/tmp1c8vk83u/job_working_directory/000/25/working/multiqc_WDir
|    custom_content | Could not parse comment file header for MultiQC custom content: file_4_0
|    custom_content | section_2: Found 1 samples (bargraph)
|    custom_content | section_4: Found 1 samples (linegraph)
|    custom_content | section_6: Found 1 samples (bargraph)
|             macs2 | Found 1 logs
|            picard | Found 1 MarkDuplicates reports
|           bowtie2 | Found 1 reports
|          cutadapt | Found 1 reports
|           multiqc | Compressing plot data
|           multiqc | Report      : report.html
|           multiqc | Data        : report_data
|           multiqc | Plots       : report_plots
|           multiqc | MultiQC complete

Standard Output:

::::::::::::::
/tmp/tmp1c8vk83u/files/7/2/4/dataset_7248a425-1b21-4a9e-9cdb-5b99bcc99568.dat
::::::::::::::
chrM	216347
others	339454
::::::::::::::
/tmp/tmp1c8vk83u/files/f/6/0/dataset_f604c8a0-e1a7-43cd-b9a5-709557faa060.dat
::::::::::::::
# localbam.bam
# Chromosome_ID	Chromosome_Size	Aligned_Reads
# chr10	135534747	5214.0
# chr11	135006516	5674.0
# chr11_gl000202_random	40103	0.0
# chr12	133851895	5404.0
# chr13	115169878	3794.0
# chr14	107349540	3422.0
# chr15	102531392	2518.0
# chr16	90354753	3218.0
# chr17_ctg5_hap1	1680828	0.0
# chr17	81195210	2880.0
# chr17_gl000203_random	37498	0.0
# chr17_gl000204_random	81310	0.0
# chr17_gl000205_random	174588	42.0
# chr17_gl000206_random	41001	0.0
# chr18	78077248	3012.0
# chr18_gl000207_random	4262	0.0
# chr19	59128983	2580.0
# chr19_gl000208_random	92689	2.0
# chr19_gl000209_random	159169	0.0
# chr1	249250621	9842.0
# chr1_gl000191_random	106433	2.0
# chr1_gl000192_random	547496	4.0
# chr20	63025520	2366.0
# chr21	48129895	1214.0
# chr21_gl000210_random	27682	0.0
# chr22	51304566	116840.0
# chr2	243199373	10050.0
# chr3	198022430	8394.0
# chr4_ctg9_hap1	590426	0.0
# chr4	191154276	8172.0
# chr4_gl000193_random	189789	2.0
# chr4_gl000194_random	191469	4.0
# chr5	180915260	7536.0
# chr6_apd_hap1	4622290	0.0
# chr6_cox_hap2	4795371	2.0
# chr6_dbb_hap3	4610396	0.0
# chr6	171115067	7054.0
# chr6_mann_hap4	4683263	2.0
# chr6_mcf_hap5	4833398	0.0
# chr6_qbl_hap6	4611984	0.0
# chr6_ssto_hap7	4928567	0.0
# chr7	159138663	6548.0
# chr7_gl000195_random	182896	16.0
# chr8	146364022	6326.0
# chr8_gl000196_random	38914	0.0
# chr8_gl000197_random	37175	0.0
# chr9	141213431	4420.0
# chr9_gl000198_random	90085	22.0
# chr9_gl000199_random	169874	2.0
# chr9_gl000200_random	187035	0.0
# chr9_gl000201_random	36148	0.0
# chrM	16571	0.0
# chrUn_gl000211	166566	6.0
# chrUn_gl000212	186858	2.0
# chrUn_gl000213	164239	0.0
# chrUn_gl000214	137718	10.0
# chrUn_gl000215	172545	0.0
# chrUn_gl000216	172294	2.0
# chrUn_gl000217	172149	24.0
# chrUn_gl000218	161147	0.0
# chrUn_gl000219	179198	10.0
# chrUn_gl000220	161802	236.0
# chrUn_gl000221	155397	2.0
# chrUn_gl000222	186861	0.0
# chrUn_gl000223	180455	0.0
# chrUn_gl000224	179693	8.0
# chrUn_gl000225	211173	8.0
# chrUn_gl000226	15008	6.0
# chrUn_gl000227	128374	0.0
# chrUn_gl000228	129120	0.0
# chrUn_gl000229	19913	82.0
# chrUn_gl000230	43691	8.0
# chrUn_gl000231	27386	84.0
# chrUn_gl000232	40652	158.0
# chrUn_gl000233	45941	32.0
# chrUn_gl000234	40531	122.0
# chrUn_gl000235	34474	50.0
# chrUn_gl000236	41934	0.0
# chrUn_gl000237	45867	66.0
# chrUn_gl000238	39939	2.0
# chrUn_gl000239	33824	2.0
# chrUn_gl000240	41933	12.0
# chrUn_gl000241	42152	118.0
# chrUn_gl000242	43523	10.0
# chrUn_gl000243	43341	12.0
# chrUn_gl000244	39929	0.0
# chrUn_gl000245	36651	2.0
# chrUn_gl000246	38154	6.0
# chrUn_gl000247	36422	0.0
# chrUn_gl000248	39786	6.0
# chrUn_gl000249	38502	0.0
# chrX	155270560	5134.0
# chrY	59373566	6.0
# Total Genome Size: 3.137161264E9	Total Aligned Tags: 232804.0
# bowtie2	# 2.5.3
# "/usr/local/bin/bowtie2-align-s --wrapper basic-0 -p 1 -x /cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full --very-sensitive -1 input_f.fastq -2 input_r.fastq"
# MarkDuplicates	# Version:3.1.1
# MarkDuplicates --TAGGING_POLICY All --INPUT SRR891268_chr22_enriched --OUTPUT /tmp/tmp1c8vk83u/job_working_directory/000/7/outputs/dataset_1439013d-363a-4ed3-9de6-dc1ad50d7afb.dat --METRICS_FILE /tmp/tmp1c8vk83u/job_working_directory/000/7/outputs/dataset_9f6e1a4a-9462-4863-acc4-55efbab5260b.dat --REMOVE_DUPLICATES true --ASSUME_SORTED true --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --VERBOSITY ERROR --QUIET true --VALIDATION_STRINGENCY LENIENT --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX <optimized capture of last three ':' separated fields as numeric values> --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false
# Average Insert Size: 162.46371196371197
# Median Insert Size: 126.0
# Std deviation of Insert Size: 117.9037267671474
# Number of ReadPairs: 116402.0
# Histogram
# Size (bp)	Frequency
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.0
20	0.0
21	0.0
22	0.0
23	1.0
24	1.0
25	11.0
26	142.0
27	117.0
28	131.0
29	130.0
30	90.0
31	88.0
32	101.0
33	116.0
34	199.0
35	385.0
36	613.0
37	761.0
38	827.0
39	1076.0
40	1305.0
41	1453.0
42	1503.0
43	1415.0
44	1214.0
45	1206.0
46	1057.0
47	969.0
48	14.0
49	19.0
50	1190.0
51	1450.0
52	1335.0
53	1142.0
54	1041.0
55	1022.0
56	934.0
57	779.0
58	759.0
59	711.0
60	711.0
61	880.0
62	926.0
63	835.0
64	905.0
65	885.0
66	765.0
67	697.0
68	651.0
69	598.0
70	638.0
71	717.0
72	749.0
73	770.0
74	736.0
75	677.0
76	653.0
77	578.0
78	569.0
79	530.0
80	508.0
81	594.0
82	631.0
83	584.0
84	605.0
85	579.0
86	593.0
87	544.0
88	487.0
89	439.0
90	395.0
91	420.0
92	469.0
93	512.0
94	484.0
95	502.0
96	473.0
97	431.0
98	380.0
99	348.0
100	350.0
101	380.0
102	343.0
103	371.0
104	420.0
105	410.0
106	414.0
107	364.0
108	363.0
109	301.0
110	281.0
111	314.0
112	306.0
113	337.0
114	331.0
115	321.0
116	329.0
117	352.0
118	293.0
119	276.0
120	261.0
121	261.0
122	254.0
123	266.0
124	250.0
125	263.0
126	294.0
127	265.0
128	256.0
129	261.0
130	250.0
131	234.0
132	209.0
133	245.0
134	253.0
135	238.0
136	272.0
137	304.0
138	288.0
139	287.0
140	248.0
141	238.0
142	225.0
143	193.0
144	221.0
145	219.0
146	226.0
147	266.0
148	238.0
149	240.0
150	268.0
151	267.0
152	255.0
153	258.0
154	212.0
155	221.0
156	229.0
157	249.0
158	256.0
159	267.0
160	228.0
161	239.0
162	255.0
163	221.0
164	232.0
165	300.0
166	330.0
167	387.0
168	371.0
169	345.0
170	288.0
171	299.0
172	251.0
173	251.0
174	303.0
175	353.0
176	370.0
177	383.0
178	421.0
179	351.0
180	289.0
181	321.0
182	270.0
183	270.0
184	322.0
185	315.0
186	324.0
187	339.0
188	348.0
189	334.0
190	305.0
191	309.0
192	291.0
193	303.0
194	323.0
195	374.0
196	348.0
197	343.0
198	306.0
199	317.0
200	308.0
201	314.0
202	307.0
203	340.0
204	349.0
205	336.0
206	340.0
207	342.0
208	314.0
209	287.0
210	330.0
211	340.0
212	297.0
213	318.0
214	272.0
215	321.0
216	336.0
217	324.0
218	347.0
219	297.0
220	314.0
221	285.0
222	286.0
223	270.0
224	305.0
225	307.0
226	287.0
227	283.0
228	289.0
229	256.0
230	284.0
231	275.0
232	265.0
233	250.0
234	256.0
235	239.0
236	226.0
237	237.0
238	225.0
239	232.0
240	214.0
241	221.0
242	235.0
243	211.0
244	170.0
245	202.0
246	218.0
247	214.0
248	178.0
249	158.0
250	185.0
251	175.0
252	158.0
253	181.0
254	192.0
255	172.0
256	143.0
257	140.0
258	156.0
259	159.0
260	143.0
261	126.0
262	160.0
263	126.0
264	128.0
265	132.0
266	139.0
267	109.0
268	134.0
269	110.0
270	122.0
271	116.0
272	126.0
273	96.0
274	120.0
275	119.0
276	123.0
277	120.0
278	125.0
279	95.0
280	99.0
281	124.0
282	113.0
283	121.0
284	113.0
285	79.0
286	88.0
287	89.0
288	105.0
289	105.0
290	101.0
291	82.0
292	100.0
293	104.0
294	97.0
295	102.0
296	95.0
297	102.0
298	96.0
299	98.0
300	98.0
301	109.0
302	115.0
303	96.0
304	85.0
305	75.0
306	84.0
307	94.0
308	119.0
309	81.0
310	98.0
311	94.0
312	101.0
313	95.0
314	87.0
315	93.0
316	102.0
317	77.0
318	91.0
319	104.0
320	100.0
321	92.0
322	82.0
323	76.0
324	82.0
325	106.0
326	101.0
327	92.0
328	83.0
329	86.0
330	91.0
331	98.0
332	78.0
333	79.0
334	98.0
335	79.0
336	93.0
337	92.0
338	94.0
339	88.0
340	77.0
341	95.0
342	89.0
343	112.0
344	90.0
345	119.0
346	106.0
347	108.0
348	113.0
349	77.0
350	95.0
351	95.0
352	96.0
353	99.0
354	97.0
355	118.0
356	92.0
357	101.0
358	99.0
359	90.0
360	103.0
361	103.0
362	109.0
363	119.0
364	117.0
365	105.0
366	123.0
367	115.0
368	121.0
369	123.0
370	112.0
371	121.0
372	115.0
373	94.0
374	116.0
375	113.0
376	106.0
377	112.0
378	103.0
379	113.0
380	104.0
381	105.0
382	114.0
383	109.0
384	110.0
385	107.0
386	110.0
387	113.0
388	115.0
389	128.0
390	130.0
391	112.0
392	128.0
393	95.0
394	119.0
395	111.0
396	109.0
397	111.0
398	115.0
399	103.0
400	106.0
401	113.0
402	107.0
403	118.0
404	103.0
405	93.0
406	111.0
407	113.0
408	130.0
409	106.0
410	102.0
411	97.0
412	92.0
413	112.0
414	101.0
415	96.0
416	93.0
417	89.0
418	102.0
419	96.0
420	98.0
421	108.0
422	92.0
423	95.0
424	80.0
425	76.0
426	103.0
427	90.0
428	80.0
429	82.0
430	94.0
431	93.0
432	84.0
433	77.0
434	91.0
435	90.0
436	72.0
437	78.0
438	71.0
439	66.0
440	77.0
441	80.0
442	78.0
443	68.0
444	63.0
445	71.0
446	70.0
447	78.0
448	56.0
449	61.0
450	59.0
451	60.0
452	49.0
453	59.0
454	65.0
455	73.0
456	56.0
457	50.0
458	72.0
459	52.0
460	60.0
461	67.0
462	57.0
463	61.0
464	53.0
465	50.0
466	52.0
467	58.0
468	44.0
469	64.0
470	52.0
471	57.0
472	47.0
473	63.0
474	48.0
475	53.0
476	57.0
477	41.0
478	49.0
479	50.0
480	60.0
481	46.0
482	42.0
483	51.0
484	47.0
485	35.0
486	40.0
487	41.0
488	51.0
489	44.0
490	36.0
491	37.0
492	48.0
493	52.0
494	49.0
495	52.0
496	56.0
497	50.0
498	42.0
499	49.0
500	46.0
::::::::::::::
/tmp/tmp1c8vk83u/files/1/2/4/dataset_1246ef9e-c5d4-4679-b133-ba3812781712.dat
::::::::::::::
in peaks	8698
outside peaks	224106
|         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 8/8

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
comment	`""`
dbkey	`"hg19"`
export	`true`
flat	`false`
results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 11, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "chrM", "software": "custom_content", "title": "reads mapping on chrM", "xlab": "", "ylab": ""}}, {"__index__": 3, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 9, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}, {"__index__": 4, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 14, "src": "hdca"}]}, "plot_type": "linegraph", "section_name": "Fragment size", "software": "custom_content", "title": "Fragment size distribution", "xlab": "", "ylab": ""}}, {"__index__": 5, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 16, "src": "hdca"}]}, "software": "macs2"}}, {"__index__": 6, "software_cond": {"__current_case__": 32, "description": "Number of reads falling 500bp from a summit", "input": {"values": [{"id": 33, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "Reads in peaks", "software": "custom_content", "title": "Number of reads in peaks", "xlab": "", "ylab": ""}}]
saveLog	`false`
title	`""`

Step 4: bin_size:
- step_state: scheduled

Step 5: Cutadapt (remove adapter + bad quality bases):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmp1c8vk83u/files/c/d/3/dataset_cd37e2cc-6e95-4392-a664-3edde4ff77fa.dat' 'SRR891268_chr22_enriched_1.fq' &&  ln -f -s '/tmp/tmp1c8vk83u/files/a/d/5/dataset_ad5b58c8-801c-439f-9219-0388112d4d0a.dat' 'SRR891268_chr22_enriched_2.fq' &&    cutadapt  -j=${GALAXY_SLOTS:-4}       -a 'Nextera R1'='CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'             -A 'Nextera R2'='CTGTCTCTTATACACATCTGACGCTGCCGACGA'       --output='out1.fq' --paired-output='out2.fq'  --error-rate=0.1 --times=1 --overlap=3    --action=trim      --minimum-length=15 --pair-filter=any    --quality-cutoff=30      'SRR891268_chr22_enriched_1.fq' 'SRR891268_chr22_enriched_2.fq'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}`
chromInfo	`"/tmp/tmp1c8vk83u/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_cassava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "minimum_length": "15", "pair_filter": "any"}`
library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTCCGAGCCCACGAGAC", "adapter_name": "Nextera R1", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTGACGCTGCCGACGA", "adapter_name": "Nextera R2", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters2": [], "cut2": "0", "front_adapters2": [], "maximum_length2": null, "minimum_length2": null, "quality_cutoff2": ""}, "type": "paired_collection"}
output_selector	`["report"]`
read_mod_options	`{"cut": "0", "length_tag": "", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "rename": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "strip_suffix": "", "trim_n": false, "zero_cap": false}`

Step 6: Bowtie2 map on reference:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmp1c8vk83u/files/c/1/f/dataset_c1ff0494-b352-4277-9dde-7f842cafff63.dat' input_f.fastq &&  ln -f -s '/tmp/tmp1c8vk83u/files/f/e/e/dataset_fee8dcfd-20b6-4506-95b4-85cd5ad73886.dat' input_r.fastq &&    bowtie2  -p ${GALAXY_SLOTS:-4}  -x '/cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full'   -1 'input_f.fastq' -2 'input_r.fastq'              --very-sensitive   2> '/tmp/tmp1c8vk83u/job_working_directory/000/4/outputs/dataset_47e2760e-a9d4-433d-b463-bbb91ae4f7ba.dat'  | samtools sort --no-PG -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp1c8vk83u/job_working_directory/000/4/outputs/dataset_4ab962b2-14c2-4a51-a098-da4f1da011ea.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}`
chromInfo	`"/tmp/tmp1c8vk83u/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 2, "aligned_file": false, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "paired_options": {"__current_case__": 1, "paired_options_selector": "no"}, "type": "paired_collection", "unaligned_file": false}`
reference_genome	`{"__current_case__": 0, "index": "hg19", "source": "indexed"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 7: filter MAPQ30 concordant pairs and not mitochondrial pairs:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmp1c8vk83u/job_working_directory/000/5/configs/tmp5h77q4xt' '/tmp/tmp1c8vk83u/job_working_directory/000/5/outputs/dataset_13fd7a0b-e746-4da3-b250-1a68f26b51e6.dat' && ln -s '/tmp/tmp1c8vk83u/files/4/a/b/dataset_4ab962b2-14c2-4a51-a098-da4f1da011ea.dat' localbam.bam && ln -s '/tmp/tmp1c8vk83u/files/_metadata_files/5/b/8/metadata_5b837188-e28d-4262-ac6e-c2abc09bcec9.dat' localbam.bam.bai && cat '/tmp/tmp1c8vk83u/job_working_directory/000/5/configs/tmp5h77q4xt' && bamtools filter -script '/tmp/tmp1c8vk83u/job_working_directory/000/5/configs/tmp5h77q4xt' -in localbam.bam -out '/tmp/tmp1c8vk83u/job_working_directory/000/5/outputs/dataset_f04e7a57-8cae-47ff-bc56-a48213cd7023.dat'

Exit Code:

```
0
```

Standard Output:

        
{
    "filters": [
        {
            "id": "1",
            "mapQuality": ">=30",
            "isProperPair": "true",
            "reference": "!chrM",
            "mateReference": "!MT"
        }
    ]
}

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
conditions	[{"__index__": 0, "filters": [{"__index__": 0, "bam_property": {"__current_case__": 14, "bam_property_selector": "mapQuality", "bam_property_value": ">=30"}}, {"__index__": 1, "bam_property": {"__current_case__": 11, "bam_property_selector": "isProperPair", "bam_property_value": true}}, {"__index__": 2, "bam_property": {"__current_case__": 20, "bam_property_selector": "reference", "bam_property_value": "!chrM"}}, {"__index__": 3, "bam_property": {"__current_case__": 16, "bam_property_selector": "mateReference", "bam_property_value": "!MT"}}]}]
dbkey	`"hg19"`
rule_configuration	`{"__current_case__": 0, "rules_selector": false}`

Step 8: Get number of reads per chromosome:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmp1c8vk83u/files/4/a/b/dataset_4ab962b2-14c2-4a51-a098-da4f1da011ea.dat' infile && ln -s '/tmp/tmp1c8vk83u/files/_metadata_files/5/b/8/metadata_5b837188-e28d-4262-ac6e-c2abc09bcec9.dat' infile.bai &&  samtools idxstats -@ $addthreads infile  > '/tmp/tmp1c8vk83u/job_working_directory/000/6/outputs/dataset_4fead233-8f5d-4a92-a854-b77fd7ed2c70.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
dbkey	`"hg19"`

Step 9: remove PCR duplicates:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

_JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS &&   ln -sf '/tmp/tmp1c8vk83u/files/f/0/4/dataset_f04e7a57-8cae-47ff-bc56-a48213cd7023.dat' 'SRR891268_chr22_enriched' &&  picard MarkDuplicates  --INPUT 'SRR891268_chr22_enriched' --OUTPUT '/tmp/tmp1c8vk83u/job_working_directory/000/7/outputs/dataset_1439013d-363a-4ed3-9de6-dc1ad50d7afb.dat'  --METRICS_FILE '/tmp/tmp1c8vk83u/job_working_directory/000/7/outputs/dataset_9f6e1a4a-9462-4863-acc4-55efbab5260b.dat'  --REMOVE_DUPLICATES 'true' --ASSUME_SORTED 'true'  --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES  --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100'   --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR

Exit Code:

```
0
```

Standard Error:

/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmp1c8vk83u/tmp
Mar 14, 2024 2:12:30 PM com.intel.gkl.NativeLibraryLoader load
INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
comments	`[]`
dbkey	`"hg19"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`true`
validation_stringency	`"LENIENT"`

Step 10: reads in chrM/MT for multiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp1c8vk83u/job_working_directory/000/8/configs/tmp_w1r19cb' '/tmp/tmp1c8vk83u/files/4/f/e/dataset_4fead233-8f5d-4a92-a854-b77fd7ed2c70.dat' > '/tmp/tmp1c8vk83u/job_working_directory/000/8/outputs/dataset_7248a425-1b21-4a9e-9cdb-5b99bcc99568.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"79622102e20b11eeb33c61d62d9dc7f4"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len"`
code	` " ($1=="chrM"
dbkey	`"hg19"`

Other invocation details
- history_id
  - bafbf713646bc54e
- history_state
  - ok
- invocation_id
  - bafbf713646bc54e
- invocation_state
  - scheduled
- workflow_id
  - bafbf713646bc54e

Updating workflows/epigenetics/atacseq from 0.9 to 0.10

eb6eccf

mvdbeek reviewed Nov 13, 2023

View reviewed changes

workflows/epigenetics/atacseq/CHANGELOG.md Outdated Show resolved Hide resolved

lldelisle closed this Nov 13, 2023

gxydevbot deleted the workflows/epigenetics/atacseq branch November 13, 2023 11:10

lldelisle mentioned this pull request Nov 13, 2023

planemo autoupdate report bug galaxyproject/planemo#1403

Closed

lldelisle restored the workflows/epigenetics/atacseq branch March 14, 2024 11:34

lldelisle reopened this Mar 14, 2024

Updating workflows/epigenetics/atacseq from 0.10 to 0.11

f953116

gxydevbot changed the title ~~Updating workflows/epigenetics/atacseq from 0.9 to 0.10~~ Updating workflows/epigenetics/atacseq from 0.9 to 0.10 Mar 14, 2024

Lucille Delisle added 2 commits March 14, 2024 13:10

fix cutadapt R2 sequence

9a14199

fix changelog and version

a669fa9

update tests

b34cbe1

fix general_stat

cb36691

fix markdup results

5a893d3

lldelisle approved these changes Mar 14, 2024

View reviewed changes

lldelisle merged commit 73cc8be into galaxyproject:main Mar 14, 2024

gxydevbot deleted the workflows/epigenetics/atacseq branch March 18, 2024 04:20

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Updating workflows/epigenetics/atacseq from 0.9 to 0.10 #276

Updating workflows/epigenetics/atacseq from 0.9 to 0.10 #276
lldelisle merged 7 commits intogalaxyproject:mainfrom
planemo-autoupdate:workflows/epigenetics/atacseq

gxydevbot commented Nov 10, 2023

Uh oh!

Uh oh!

github-actions bot commented Mar 14, 2024

Workflow invocation details

Uh oh!

github-actions bot commented Mar 14, 2024

Workflow invocation details

Uh oh!

github-actions bot commented Mar 14, 2024

Workflow invocation details

Uh oh!

github-actions bot commented Mar 14, 2024

Workflow invocation details

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

3 participants

Conversation

gxydevbot commented Nov 10, 2023

Uh oh!

Uh oh!

github-actions bot commented Mar 14, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

github-actions bot commented Mar 14, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

github-actions bot commented Mar 14, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

github-actions bot commented Mar 14, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

3 participants