Important: I strongly recommend reading this documentation on the pkgdown documentation website rather than on GitHub! The website includes proper formatting, a dynamic table of contents, an embedded interactive GUI for the tools, full documentation and examples for all functions, and a much better reading experience. Bear in mind that GitHub always displays the latest version of the README (usually a dev version) while the main website is for the latest release version – however, the latest dev section of the website always matches the latest dev GitHub.
ggDNAvis is an R package that uses ggplot2 to visualise genetic data of three main types:
-
a single DNA/RNA sequence split across multiple lines,
-
multiple DNA/RNA sequences, each occupying a whole line, or
-
base modifications such as DNA methylation called by modified-bases models in Dorado or Guppy.
This is accomplished through main functions
visualise_single_sequence(), visualise_many_sequences(), and
visualise_methylation() respectively. Each of these has helper
sequences for streamlined data processing, as detailed later in the
section for each visualisation type.
Additionally, ggDNAvis contains a built-in example dataset
(example_many_sequences) and a set of colour palettes for DNA
visualisation (sequence_colour_palettes).
As of v1.0.0, aliases are now fully configured so either American or
British spellings should work. “Colour” and “visualise” remain the
spellings used throughout the code and documentation but “color”, “col”,
and “visualize” should also work in all function and argument names
(e.g. visualize_single_sequence()). If any American spellings don’t
work then please submit a bug report at
https://github.com/ejade42/ggDNAvis/issues.
The latest release of ggDNAvis is available from CRAN or via github releases. Alternatively, the latest in-development version can be installed directly from the github repository, but may have unexpected bugs.
## Latest release version
install.packages("ggDNAvis")
## Current development build (may have unexpected bugs!)
devtools::install_github("ejade42/ggDNAvis")
## Specific version from github
devtools::install_github("ejade42/ggDNAvis", ref = "v1.0.0")Throughout this manual, only ggDNAvis, dplyr, and ggplot2 are
loaded. The following chunk provides setup for rendering this README
page and should NOT be copied verbatim. If you are trying to work
through the examples, use the alternative setup chunk below.
## THIS SETUP CHUNK IS FOR THE WEBPAGE AND WILL NOT WORK FOR RUNNING THE EXAMPLES LOCALLY
## Load this package
library(ggDNAvis)
## Load useful tidyverse packages
## These are ggDNAvis dependencies, so will always be installed when installing ggDNAvis
library(dplyr)
library(ggplot2)
## Function for viewing tables throughout this document
## This is not a package data-processing function, it just helps make this document
print_table <- function(data) {
quoted <- as.data.frame(
lapply(data, function(x) {paste0("`", x, "`")}),
check.names = FALSE
)
kable_output <- knitr::kable(quoted)
return(kable_output)
}
## Function for viewing figures throughout this document
view_image <- function(filename) {
knitr::include_graphics(filename)
}
## Set up file locations
output_location <- "README_files/output/"
display_location <- "https://raw.githubusercontent.com/ejade42/ggDNAvis/main/README_files/output/"
knitr::opts_chunk$set(fig.path = output_location)
## Print current ggDNAvis version
cat("Loaded ggDNAvis version is:", as.character(packageVersion("ggDNAvis")))## Loaded ggDNAvis version is: 1.0.0.9000
If you are working through the examples, use this setup chunk instead:
## THIS SETUP CHUNK WILL ALLOW YOU TO RUN THE EXAMPLES YOURSELF
## Load pacakges
library(ggDNAvis)
library(dplyr)
library(ggplot2)
library(magick) ## additional - needed for viewing images
## Function for printing tables to console
print_table <- function(data) {
quoted <- as.data.frame(
lapply(data, function(x) {paste0("`", x, "`")}),
check.names = FALSE
)
table_output <- tibble(quoted)
return(table_output)
}
## Function for viewing figures in plot window
view_image <- function(filename) {
plot(image_read(filename))
}
## File location to output to
output_location <- "PUT YOUR FOLDER NAME HERE ENDING IN A SLASH/"
display_location <- output_location # you probably want these to be the same
## Print current ggDNAvis version
cat("Loaded ggDNAvis version is:", as.character(packageVersion("ggDNAvis")))An interactive GUI-based version of ggDNAvis that runs in a browser is available from the “interactive app” tab of the top navbar of this website, or directly from https://ejade42-ggdnavis.share.connect.posit.cloud/.
This is implemented via a Shiny app, which can also be launched from R
on any local computer that has ggDNAvis installed, via the
ggDNAvis_shinyapp() function:
ggDNAvis_shinyapp()The files for the app are stored in the inst/shinyapp/ directory,
accessible via system.file("shinyapp/", package = "ggDNAvis").
This section contains one example for each type of visualisation. See the relevant full sections for more details and customisation options.
## Create input sequence. This can be any DNA/RNA string
sequence <- "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGC"
## Create visualisation
## This lists out all arguments
## Usually it's fine to leave most of these as defaults
visualise_single_sequence(
sequence = sequence,
sequence_colours = sequence_colour_palettes$bright_pale,
background_colour = "white",
line_wrapping = 60,
spacing = 1,
margin = 0.5,
sequence_text_colour = "black",
sequence_text_size = 16,
index_annotation_colour = "darkred",
index_annotation_size = 12.5,
index_annotation_interval = 15,
index_annotations_above = TRUE,
index_annotation_vertical_position = 1/3,
index_annotation_always_first_base = TRUE,
index_annotation_always_last_base = TRUE,
outline_colour = "black",
outline_linewidth = 3,
outline_join = "mitre",
return = FALSE,
filename = paste0(output_location, "summary_single_sequence.png"),
force_raster = FALSE,
render_device = ragg::agg_png,
pixels_per_base = 100,
monitor_performance = FALSE
)
## View image
view_image(paste0(display_location, "summary_single_sequence.png"))## Read and merge data
fastq_data <- read_fastq(system.file("extdata/example_many_sequences_raw.fastq", package = "ggDNAvis"), calculate_length = TRUE)
metadata <- read.csv(system.file("extdata/example_many_sequences_metadata.csv", package = "ggDNAvis"))
merged_fastq_data <- merge_fastq_with_metadata(fastq_data, metadata)
## Extract character vector
## These arguments should all be considered, as they are highly specific to your data
sequences_for_visualisation <- extract_and_sort_sequences(
sequence_dataframe = merged_fastq_data,
sequence_variable = "forward_sequence",
grouping_levels = c("family" = 8, "individual" = 2),
sort_by = "sequence_length",
desc_sort = TRUE
)
## Create visualisation
## Usually it's fine to leave most of these as defaults
visualise_many_sequences(
sequences_vector = sequences_for_visualisation,
sequence_colours = sequence_colour_palettes$bright_deep,
background_colour = "white",
margin = 0.5,
sequence_text_colour = "white",
sequence_text_size = 16,
index_annotation_lines = c(1, 23, 37),
index_annotation_colour = "darkred",
index_annotation_size = 12.5,
index_annotation_interval = 3,
index_annotations_above = TRUE,
index_annotation_vertical_position = 1/3,
index_annotation_full_line = FALSE,
index_annotation_always_first_base = FALSE,
index_annotation_always_last_base = FALSE,
outline_colour = "black",
outline_linewidth = 3,
outline_join = "mitre",
return = FALSE,
filename = paste0(output_location, "summary_many_sequences.png"),
force_raster = FALSE,
render_device = ragg::agg_png,
pixels_per_base = 100,
monitor_performance = FALSE
)
## View image
view_image(paste0(display_location, "summary_many_sequences.png"))## Read and merge data
modification_data <- read_modified_fastq(system.file("extdata/example_many_sequences_raw_modified.fastq", package = "ggDNAvis"))
metadata <- read.csv(system.file("extdata/example_many_sequences_metadata.csv", package = "ggDNAvis"))
merged_modification_data <- merge_methylation_with_metadata(
modification_data,
metadata,
reversed_location_offset = 1
)
## Extract list of character vectors
## These arguments should all be considered, as they are highly specific to your data
methylation_for_visualisation <- extract_and_sort_methylation(
modification_data = merged_modification_data,
locations_colname = "forward_C+m?_locations",
probabilities_colname = "forward_C+m?_probabilities",
lengths_colname = "sequence_length",
grouping_levels = c("family" = 8, "individual" = 2),
sort_by = "sequence_length",
desc_sort = TRUE
)
## Create visualisation
## Usually it's fine to leave most of these as defaults
visualise_methylation(
modification_locations = methylation_for_visualisation$locations,
modification_probabilities = methylation_for_visualisation$probabilities,
sequences = methylation_for_visualisation$sequences,
low_colour = "blue",
high_colour = "red",
low_clamp = 0.1*255,
high_clamp = 0.9*255,
background_colour = "white",
other_bases_colour = "grey",
sequence_text_type = "none",
index_annotation_lines = 1:51,
index_annotation_colour = "darkred",
index_annotation_size = 12.5,
index_annotation_interval = 9,
index_annotations_above = TRUE,
index_annotation_vertical_position = 1/3,
index_annotation_full_line = FALSE,
index_annotation_always_first_base = TRUE,
index_annotation_always_last_base = TRUE,
outline_colour = "black",
outline_linewidth = 3,
outline_join = "mitre",
margin = 0.5,
return = FALSE,
filename = paste0(output_location, "summary_methylation_none.png"),
force_raster = FALSE,
render_device = ragg::agg_png,
pixels_per_base = 100,
monitor_performance = FALSE
)
## View image
view_image(paste0(display_location, "summary_methylation_none.png"))## Create visualisation showing sequence
visualise_methylation(
modification_locations = methylation_for_visualisation$locations,
modification_probabilities = methylation_for_visualisation$probabilities,
sequences = methylation_for_visualisation$sequences,
low_colour = "blue",
high_colour = "red",
low_clamp = 0.1*255,
high_clamp = 0.9*255,
background_colour = "white",
other_bases_colour = "grey",
sequence_text_type = "sequence",
sequence_text_colour = "black",
sequence_text_size = 16,
index_annotation_lines = c(1, 23, 37),
index_annotation_colour = "darkred",
index_annotation_size = 12.5,
index_annotation_interval = 15,
index_annotations_above = TRUE,
index_annotation_vertical_position = 1/3,
index_annotation_full_line = TRUE,
index_annotation_always_first_base = TRUE,
index_annotation_always_last_base = FALSE,
outline_colour = "black",
outline_join = "mitre",
modified_bases_outline_linewidth = 3,
other_bases_outline_linewidth = 1,
margin = 0.5,
return = FALSE,
filename = paste0(output_location, "summary_methylation_sequence.png"),
render_device = ragg::agg_png,
pixels_per_base = 100
)
## View image
view_image(paste0(display_location, "summary_methylation_sequence.png"))## Create visualisation showing probabilities
visualise_methylation(
modification_locations = methylation_for_visualisation$locations,
modification_probabilities = methylation_for_visualisation$probabilities,
sequences = methylation_for_visualisation$sequences,
low_colour = "blue",
high_colour = "red",
low_clamp = 0.1*255,
high_clamp = 0.9*255,
background_colour = "white",
other_bases_colour = "grey",
sequence_text_type = "probability",
sequence_text_scaling = c(-0.5, 256),
sequence_text_rounding = 2,
sequence_text_colour = "white",
sequence_text_size = 10,
index_annotation_lines = c(1, 23, 37),
index_annotation_colour = "darkred",
index_annotation_size = 12.5,
index_annotation_interval = 15,
index_annotations_above = TRUE,
index_annotation_vertical_position = 1/3,
index_annotation_full_line = TRUE,
index_annotation_always_first_base = TRUE,
index_annotation_always_last_base = FALSE,
outline_colour = "black",
outline_join = "mitre",
modified_bases_outline_linewidth = 3,
other_bases_outline_linewidth = 1,
margin = 0.5,
return = FALSE,
filename = paste0(output_location, "summary_methylation_probabilities.png"),
render_device = ragg::agg_png,
pixels_per_base = 100
)
## View image
view_image(paste0(display_location, "summary_methylation_probabilities.png"))## Create visualisation showing probability integers
visualise_methylation(
modification_locations = methylation_for_visualisation$locations,
modification_probabilities = methylation_for_visualisation$probabilities,
sequences = methylation_for_visualisation$sequences,
low_colour = "blue",
high_colour = "red",
low_clamp = 0.1*255,
high_clamp = 0.9*255,
background_colour = "white",
other_bases_colour = "grey",
sequence_text_type = "probability",
sequence_text_scaling = c(0, 1),
sequence_text_rounding = 0,
sequence_text_colour = "white",
sequence_text_size = 10,
index_annotation_lines = c(1, 23, 37),
index_annotation_colour = "darkred",
index_annotation_size = 12.5,
index_annotation_interval = 15,
index_annotations_above = TRUE,
index_annotation_vertical_position = 1/3,
index_annotation_full_line = TRUE,
index_annotation_always_first_base = TRUE,
index_annotation_always_last_base = TRUE,
outline_colour = "black",
outline_join = "mitre",
modified_bases_outline_linewidth = 3,
other_bases_outline_linewidth = 1,
margin = 0.5,
return = FALSE,
filename = paste0(output_location, "summary_methylation_probability_integers.png"),
render_device = ragg::agg_png,
pixels_per_base = 100
)
## View image
view_image(paste0(display_location, "summary_methylation_probability_integers.png"))## Create scalebar and save to ggplot object
## Usually it's fine to leave most of these as defaults
scalebar <- visualise_methylation_colour_scale(
low_colour = "blue",
high_colour = "red",
low_clamp = 0.1*255,
high_clamp = 0.9*255,
full_range = c(0, 255),
precision = 10^3,
background_colour = "white",
axis_location = "bottom",
axis_title = "Methylation probability",
do_axis_ticks = TRUE,
outline_colour = "black",
outline_linewidth = 1
)
## Write png from object (the object is just a standard ggplot)
ggsave(paste0(output_location, "summary_methylation_scalebar.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "summary_methylation_scalebar.png"))ggDNAvis comes with example dataset example_many_sequences. In this
data, each row/observation represents one read. Reads are associated
with metadata such as the participant and family to which they belong,
and with sequence data such as the DNA sequence, FASTQ quality scores,
and modification information retrieved from the MM and ML tags in a
SAM/BAM file.
## View the first 4 rows of example_many_sequences data
print_table(head(example_many_sequences, 4))| family | individual | read | sequence | sequence_length | quality | methylation_locations | methylation_probabilities | hydroxymethylation_locations | hydroxymethylation_probabilities |
|---|---|---|---|---|---|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
Family 1 |
F1-1 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
Family 1 |
F1-1 |
F1-1c |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
87 |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
206,141,165,80,159,84,128,173,124,62,195,19,79,183,129,39,129,126,192,45 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
40,63,58,55,60,56,64,56,64,47,46,17,55,52,64,33,63,64,47,37 |
Family 1 |
F1-1 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
The DNA sequence in column sequence is the information used for
visualising single/multiple sequences. For visualising DNA modification,
this data contains information on both 5-cytosine-methylation and
5-cytosine-hydroxymethylation. For a given modification type
(e.g. methylation), visualisation requires a column of locations and a
column of probabilities. In this dataset, the relevant columns are
methylation_locations and methylation_probabilities for methylation
and hydroxymethylation_locations and
hydroxymethylation_probabilities for hydroxymethylation.
Locations are stored as a comma-condensed string of integers for each
read, produced via vector_to_string(), and indicate the indices along
the read at which the probability of modification was assessed. For
example, methylation might be assessed at each CpG site, which in the
read "GGCGGCGGAGGCGGCGGA" would be the third, sixth, twelfth, and
fifteenth bases, thus the location string would be "3,6,12,15" for
that read.
Probabilities are also a comma-condensed string of integers produced via
vector_to_string(), but here each integer represents the probability
that the corresponding base is modified. Probabilities are stored as
8-bit integers (0-255) where a score of "250,3,50,127" would indicate that the third
base is almost certainly methylated (97.66%-98.05%), the sixth base is
almost certainly not methylated (1.17%-1.56%), the twelfth base is most
likely not methylated (19.53%-19.92%), and the fifteenth base may or may
not be methylated (49.61%-50.00%)
## Function to convert integer scores to corresponding percentages
convert_8bit_to_decimal_prob <- function(x) {
return(c( x / 256,
(x+1) / 256))
}
## Convert comma-condensed string back to numerical vector
## string_to_vector() and vector_to_string() are crucial ggDNAvis helpers
probabilities <- string_to_vector("250,3,50,127")
## For each probability, print 8-bit score then percentage range
for (probability in probabilities) {
percentages <- round(convert_8bit_to_decimal_prob(probability), 4) * 100
cat("8-bit probability: ", probability, "\n", sep = "")
cat("Decimal probability: ", percentages[1], "% - ", percentages[2], "%", "\n\n", sep = "")
}## 8-bit probability: 250
## Decimal probability: 97.66% - 98.05%
##
## 8-bit probability: 3
## Decimal probability: 1.17% - 1.56%
##
## 8-bit probability: 50
## Decimal probability: 19.53% - 19.92%
##
## 8-bit probability: 127
## Decimal probability: 49.61% - 50%
Lots of the data used in ggDNAvis requires a series of multiple values
to be stored within a single observation in a dataframe. The solution
used here is condensing vectors to a single string (character value) for
simple storage, then reconstituting the original vectors when needed.
These functions are basic wrappers around strsplit() and
paste(, collapse = ",") but are easy to use and readable.
Additionally, these can be used when reading SAM/BAM MM and ML tags, which are stored as comma-separated lists within modified FASTQ files, so can also be processed using these functions.
vector_to_string(c(1, 2, 3, 4))## [1] "1,2,3,4"
string_to_vector("1,2,3,4") # the default vector type is numeric## [1] 1 2 3 4
vector_to_string(c("these", "are", "some", "words"))## [1] "these,are,some,words"
string_to_vector("these,are,some,words", type = "character")## [1] "these" "are" "some" "words"
vector_to_string(c(TRUE, FALSE, TRUE))## [1] "TRUE,FALSE,TRUE"
string_to_vector("TRUE,FALSE,TRUE", type = "logical")## [1] TRUE FALSE TRUE
If multiple strings (i.e. a character vector) are input to
string_to_vector(), it will concatenate them and produce a single
output vector. This is intended, useful behaviour to help with some of
the visualisation code in this package. If a list of separate vectors
for each input value is desired, lapply() can be used.
string_to_vector(c("1,2,3", "4,5,6"))## [1] 1 2 3 4 5 6
lapply(c("1,2,3", "4,5,6"), string_to_vector)## [[1]]
## [1] 1 2 3
##
## [[2]]
## [1] 4 5 6
To read in a normal FASTQ file (containing a read ID/header, sequence,
and quality scores for each read), the function read_fastq() can be
used. The example data file for this is
inst/extdata/example_many_sequences_raw.fastq, accessible via
system.file("extdata/example_many_sequences_raw.fastq", package = "ggDNAvis"):
## Look at first 16 lines of FASTQ
fastq_raw <- readLines(system.file("extdata/example_many_sequences_raw.fastq", package = "ggDNAvis"))
for (i in 1:16) {
cat(fastq_raw[i], "\n")
}## F1-1a
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## )8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90
## F1-1b
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## 60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139
## F1-1c
## TCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCC
## +
## @9889C8<<*96;52!*86,227.<I.8AI<>;2/391%D19*5@G=8<7<:!7+;:I:-!03<0AI>9?4!57I*-C#25FD24F;
## F1-1d
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## :<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0
## Load data from FASTQ
fastq_data <- read_fastq(
system.file("extdata/example_many_sequences_raw.fastq", package = "ggDNAvis"),
calculate_length = TRUE,
strip_at = TRUE
)
## View first 4 rows
print_table(head(fastq_data, 4))| read | sequence | quality | sequence_length |
|---|---|---|---|
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
102 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
63 |
F1-1c |
TCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCC |
@9889C8<<*96;52!*86,227.<I.8AI<>;2/391%D19*5@G=8<7<:!7+;:I:-!03<0AI>9?4!57I*-C#25FD24F; |
87 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
81 |
Using the basic read_fastq() function returns a dataframe with read
ID, sequence, and quality columns. Optionally, a sequence_length
column can be generated by setting calculate_length = TRUE. However,
we can see that some of the sequences (e.g. F1-1c) are reversed. This
occurs when the read is of the - strand at the biochemical level.
To convert reverse reads to their forward equivalents, and incorporate
additional data such as the participant and family to which each read
belongs, we will make use of a metadata file located at
inst/extdata/example_many_sequences_metadata.csv.
Depending on how the FASTQ was created, the read IDs may be prefixed
with @ (e.g. samtools fastq generally leaves these @s). This can
cause issues with metadata merging if the FASTQ has @ at the start of
each read ID but the metadata doesn’t, as then the reads can’t be
matched up. The strip_at argument in read_fastq() and
read_modified_fastq() (on by default), removes a single leading @
from each read ID that starts with @, and does nothing to read IDs
that don’t start with @. If the metadata does have IDs beginning
with @, then they can be kept in the FASTQ data by setting
strip_at = FALSE.
## Load metadata from CSV
metadata <- read.csv(system.file("extdata/example_many_sequences_metadata.csv", package = "ggDNAvis"))
## View first 4 rows
print_table(head(metadata, 4))| family | individual | read | direction |
|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
forward |
Family 1 |
F1-1 |
F1-1b |
forward |
Family 1 |
F1-1 |
F1-1c |
reverse |
Family 1 |
F1-1 |
F1-1d |
forward |
We see that this metadata file contains the same read column with the
same unique read IDs and a direction column specifying whether each
read is "forward" or "reverse". These two columns are mandatory.
Additionally, we have family and participant ID columns providing
additional information on each read.
Note: the direction column can be produced manually. However, for
large data volumes it may be more effective to use SAMtools to write TXT
files of all forward and reverse read IDs via the -F/-f 16 flags,
e.g.:
## bash/shell code for using SAMtools on the command line:
## See the samtools flag documentation for more details on why
## -F 16 selects forward reads and -f 16 selects reverse reads
samtools view -F 16 ${input_bam_file} | \
awk '{print $1}' > "forward_reads.txt"
samtools view -f 16 ${input_bam_file} | \
awk '{print $1}' > "reverse_reads.txt"Then simply read the lines from each file and use that to assign directions:
## Use files from last step to construct vectors of forward and reverse IDs
forward_reads <- readLines("forward_reads.txt")
reverse_reads <- readLines("reverse_reads.txt")
## Use rep() to add a direction column
constructed_metadata <- data.frame(
read = c(forward_reads, reverse_reads),
direction = c(rep("forward", length(forward_reads)),
rep("reverse", length(reverse_reads)))
)In any case, once we have metadata with the read and direction
columns, we can use merge_fastq_with_metadata() to combine the
metadata and the fastq data. Crucially, this function uses the
direction column of the metadata to determine which reads are reverse,
and reverse-complements these reverse reads only to produce a new column
containing the forward version of all reads.
Note that there are three options for how to manage these reverse reads:
reverse_complement_mode = "DNA"reverse-complements, with A being mapped to T. This is the default.reverse_complement_mode = "RNA"reverse-complements, with A being mapped to U.reverse_complement_mode = "reverse_only"reverses but does not complement, meaning reverse reads will be shown 3’-5’ (i.e. complementary to the 5’-3’ forward reads) as opposed to being complemented into the 5’-3’ forward reads.
This example with proceed with the default
reverse_complement_mode = "DNA", but be aware that "reverse_only" is
an option if reverse reads want to be visualised aligned with forward
reads without complementing.
## Merge fastq data with metadata
## This function reverse-complements reverse reads to get all forward versions
merged_fastq_data <- merge_fastq_with_metadata(fastq_data, metadata)
## View first 4 rows
print_table(head(merged_fastq_data, 4))| read | family | individual | direction | sequence | quality | sequence_length | forward_sequence | forward_quality |
|---|---|---|---|---|---|---|---|---|
F1-1a |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
102 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
F1-1b |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
63 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
F1-1c |
Family 1 |
F1-1 |
reverse |
TCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCC |
@9889C8<<*96;52!*86,227.<I.8AI<>;2/391%D19*5@G=8<7<:!7+;:I:-!03<0AI>9?4!57I*-C#25FD24F; |
87 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
F1-1d |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
81 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
Now we have a forward_sequence column (scroll to the right if you
can’t see it!). We can now reformat this data to be exactly the same as
the included example_many_sequences data:
## Subset to only the columns present in example_many_sequences
merged_fastq_data <- merged_fastq_data[, c("family", "individual", "read", "forward_sequence", "sequence_length", "forward_quality")]
## Rename "forward_sequence" to "sequence" and same for quality
colnames(merged_fastq_data)[c(4,6)] <- c("sequence", "quality")
## View first 4 rows of data produced from files
print_table(head(merged_fastq_data, 4))| family | individual | read | sequence | sequence_length | quality |
|---|---|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
Family 1 |
F1-1 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
Family 1 |
F1-1 |
F1-1c |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
87 |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
Family 1 |
F1-1 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
## View first 4 rows of example_many_sequences (with modification columns excluded)
print_table(head(example_many_sequences[, 1:6], 4))| family | individual | read | sequence | sequence_length | quality |
|---|---|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
Family 1 |
F1-1 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
Family 1 |
F1-1 |
F1-1c |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
87 |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
Family 1 |
F1-1 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
## Check if equal
identical(merged_fastq_data, example_many_sequences[, 1:6])## [1] TRUE
So, from just a standard FASTQ file and a simple metadata CSV we have
successfully reproduced the example_many_sequences data (excluding
methylation/modification information) via read_fastq() and
merge_fastq_with_metadata(). We can also write from this dataframe to
FASTQ using write_fastq():
## Use write_fastq with filename = NA and return = TRUE to create the FASTQ,
## but return it as a character vector rather than writing to file.
output_fastq <- write_fastq(
merged_fastq_data,
filename = NA,
return = TRUE,
read_id_colname = "read",
sequence_colname = "sequence",
quality_colname = "quality"
)
## View first 16 lines
for (i in 1:16) {
cat(output_fastq[i], "\n")
}## F1-1a
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## )8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90
## F1-1b
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## 60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139
## F1-1c
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## ;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@
## F1-1d
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## :<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0
Note that this is not quite identical to the original. That’s because we wrote from the forward-sequence and forward-quality columns (after renaming), so the new FASTQ contains all forward versions. If we wanted the original FASTQ we would just provide colnames for the original sequence and quality rather than the forward versions.
Do be careful that either both sequence and quality are the forward versions or neither are. If they are mismatched then the new FASTQ will be wrong.
FASTQ files can be modified to include DNA modification (most often 5-cytosine-methylation) information within the header lines. This is a very specific file format that is generally produced under the following conditions:
- Oxford Nanopore sequencing is used
- Raw FAST5/POD5/BLOW5 signal files are basecalled to SAM/BAM using a modification-capable model in Guppy or Dorado (see modified basecalling documentation)
- SAM/BAM, which stores modification information in the MM and ML tags, is converted to FASTQ with MM/ML information copied to header rows via:
samtools fastq -T MM,ML ${input_bam_file} > "modified_fastq_file.fastq"ggDNAvis then contains tools for reading from, processing, and writing
to these modified FASTQ files. The example data file for this is
inst/extdata/example_many_sequences_raw_modified.fastq, accessible via
system.file("extdata/example_many_sequences_raw_modified.fastq", package = "ggDNAvis"):
## Look at first 16 lines of FASTQ
modified_fastq_raw <- readLines(system.file("extdata/example_many_sequences_raw_modified.fastq", package = "ggDNAvis"))
for (i in 1:16) {
cat(modified_fastq_raw[i], "\n")
}## F1-1a MM:Z:C+h?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0;C+m?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0; ML:B:C,26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34,29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## )8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90
## F1-1b MM:Z:C+h?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0;C+m?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0; ML:B:C,10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2,10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## 60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139
## F1-1c MM:Z:C+h?,1,1,5,1,1,5,1,1,5,1,1,5,1,1,1,1,1,1,1,1;C+m?,1,1,5,1,1,5,1,1,5,1,1,5,1,1,1,1,1,1,1,1; ML:B:C,37,47,64,63,33,64,52,55,17,46,47,64,56,64,56,60,55,58,63,40,45,192,126,129,39,129,183,79,19,195,62,124,173,128,84,159,80,165,141,206
## TCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCC
## +
## @9889C8<<*96;52!*86,227.<I.8AI<>;2/391%D19*5@G=8<7<:!7+;:I:-!03<0AI>9?4!57I*-C#25FD24F;
## F1-1d MM:Z:C+h?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0;C+m?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0; ML:B:C,33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55,216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## :<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0
This file is identical to the standard FASTQ seen in the reading
standard FASTQ section in the sequence and quality
lines, but has the MM and ML tags stored in the header. See the SAM
tags specification or
the documentation for read_modified_fastq(),
merge_methylation_with_metadata(), and reverse_locations_if_needed()
for a comprehensive explanation of how these store
methylation/modification information.
The modification information stored in these FASTQ header lines can be
parsed with read_modified_fastq(). This converts the locations from
the SAM/BAM MM format to simply being the indices along the read at
which modification was assessed (starting indexing at 1). For example,
in F1-1a, the C+m? (methylation) locations start "3,6,9,12",
indicating that the third, sixth, ninth, and twelfth bases in the read
were assessed for probability of methylation. Checking the sequence, we
see that all of these are CpG sites (CG dinucleotides), which are the
main DNA methylation sites in the genome. For each assessed site, the
modification probability is given as an 8-bit integer (0-255), where 0
represents ~0% modification probability and 255 represents ~100%
modification probability (this is fully explained in introduction to
example_many_sequences).
## Load data from FASTQ
methylation_data <- read_modified_fastq(
system.file("extdata/example_many_sequences_raw_modified.fastq", package = "ggDNAvis"),
strip_at = TRUE
)
## View first 4 rows
print_table(head(methylation_data, 4))| read | sequence | sequence_length | quality | modification_types | C+h?_locations | C+h?_probabilities | C+m?_locations | C+m?_probabilities |
|---|---|---|---|---|---|---|---|---|
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
F1-1c |
TCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCC |
87 |
@9889C8<<*96;52!*86,227.<I.8AI<>;2/391%D19*5@G=8<7<:!7+;:I:-!03<0AI>9?4!57I*-C#25FD24F; |
C+h?,C+m? |
3,6,15,18,21,30,33,36,45,48,51,60,63,66,69,72,75,78,81,84 |
37,47,64,63,33,64,52,55,17,46,47,64,56,64,56,60,55,58,63,40 |
3,6,15,18,21,30,33,36,45,48,51,60,63,66,69,72,75,78,81,84 |
45,192,126,129,39,129,183,79,19,195,62,124,173,128,84,159,80,165,141,206 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
Ultimately, read_modified_fastq() outputs a dataframe with the
standard read information (ID, sequence, length, quality), a column
stating which modification types were assessed for each read
(e.g. "C+h?" for hydroxymethylation or "C+m?" for methylation -
refer to the SAM tags
specification), and
for each modification type, a column of assessed locations (indices
along the read) and a column of modification probabilities (as 8-bit
integers).
Modification types, locations, and probabilities are all stored as
comma-condensed strings produced from vectors via vector_to_string().
These can be converted back to vectors via string_to_vector() - see
introduction to string/vector
functions.
As with the standard FASTQ, some of the reads in the modified FASTQ are
reverse. However, as the assessed modification locations are indices
along the read and the probabilities correspond to locations in
sequence, the modification information needs to be reversed in addition
to reverse complementing the DNA sequence. Analogous to before, this is
achieved via the merge_methylation_with_metadata() function.
## Load metadata from CSV
metadata <- read.csv(system.file("extdata/example_many_sequences_metadata.csv", package = "ggDNAvis"))
## View first 4 rows
print_table(head(metadata, 4))| family | individual | read | direction |
|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
forward |
Family 1 |
F1-1 |
F1-1b |
forward |
Family 1 |
F1-1 |
F1-1c |
reverse |
Family 1 |
F1-1 |
F1-1d |
forward |
The metadata is identical to its previous use in the reading from standard FASTQ section.
## Merge fastq data with metadata
## This function reverse-complements reverse reads to get all forward versions
## And correctly flips location and probability information
## See ?merged_methylation_data and ?reverse_locations_if_needed for details
merged_methylation_data <- merge_methylation_with_metadata(methylation_data, metadata)
## View first 4 rows
print_table(head(merged_methylation_data, 4))| read | family | individual | direction | sequence | sequence_length | quality | modification_types | C+h?_locations | C+h?_probabilities | C+m?_locations | C+m?_probabilities | forward_sequence | forward_quality | forward_C+h?_locations | forward_C+h?_probabilities | forward_C+m?_locations | forward_C+m?_probabilities |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
F1-1a |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
F1-1b |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
F1-1c |
Family 1 |
F1-1 |
reverse |
TCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCC |
87 |
@9889C8<<*96;52!*86,227.<I.8AI<>;2/391%D19*5@G=8<7<:!7+;:I:-!03<0AI>9?4!57I*-C#25FD24F; |
C+h?,C+m? |
3,6,15,18,21,30,33,36,45,48,51,60,63,66,69,72,75,78,81,84 |
37,47,64,63,33,64,52,55,17,46,47,64,56,64,56,60,55,58,63,40 |
3,6,15,18,21,30,33,36,45,48,51,60,63,66,69,72,75,78,81,84 |
45,192,126,129,39,129,183,79,19,195,62,124,173,128,84,159,80,165,141,206 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
4,7,10,13,16,19,22,25,28,37,40,43,52,55,58,67,70,73,82,85 |
40,63,58,55,60,56,64,56,64,47,46,17,55,52,64,33,63,64,47,37 |
4,7,10,13,16,19,22,25,28,37,40,43,52,55,58,67,70,73,82,85 |
206,141,165,80,159,84,128,173,124,62,195,19,79,183,129,39,129,126,192,45 |
F1-1d |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
The merged methylation data contains forward_ rows for sequence and
quality, as before, but also for hydroxymethylation and methylation
locations and probabilities. However, looking at the modification
locations columns (scroll right on the table), we can see that the
indices assessed for modification are 4, 7, 10 etc for sequence
"GGCGGCGGCGGC...". This is because the actual biochemical modification
was on the Cs on the reverse strand, corresponding to Gs on the forward
strand according to Watson-Crick base pairing. For many purposes, it may
be desirable to keep these positions to indicate that in reality, the
modification occurred at exactly that location on the other strand. This
is accomplished by setting offset = 0 (the default) inside
merge_methylation_with_metadata().
However, there is also the option to offset the modification locations
by 1. For symmetrical modification sites such as CGs, this means that
when the C on the reverse strand is modified, that gets attributed to
the C on the forward strand even though the direct complementary base
is the G. The advantage of this is that it means CG sites
(i.e. potential methylation sites) always have 5-methylcytosine
modifications associated with the C of each CG, regardless of which
strand the information came from. This is also often useful, as it
ensures the information is consistent and (provided locations are
palindromic when reverse-complemented) modifications are always attached
to the correct base e.g. C-methylation to C. This is accomplished by
setting offset = 1 inside merge_methylation_with_metadata().
Either of these options can be valid and useful, but make sure you think about it!
## Here the stars represent the true biochemical modifications on the reverse strand:
## (occurring at the Cs of CGs in the 5'-3' direction)
##
##
## 5' GGCGGCGGCGGCGGCGGA 3'
## 3' CCGCCGCCGCCGCCGCCT 5'
## * * * * *
## If we take the complementary locations on the forward strand,
## the modification locations correspond to Gs rather than Cs,
## but are in the exact same locations:
##
## o o o o o
## 5' GGCGGCGGCGGCGGCGGA 3'
## 3' CCGCCGCCGCCGCCGCCT 5'
## * * * * *
## If we offset the locations by 1 on the forward strand,
## the modifications are always associated with the C of a CG,
## but the locations are moved slightly:
##
## o o o o o
## 5' GGCGGCGGCGGCGGCGGA 3'
## 3' CCGCCGCCGCCGCCGCCT 5'
## * * * * *
We will proceed with offset = 1 so that the forward versions match up
with example_many_sequences.
## Merge fastq data with metadata, offsetting reversed locations by 1
merged_methylation_data <- merge_methylation_with_metadata(
methylation_data,
metadata,
reversed_location_offset = 1
)
## View first 4 rows
print_table(head(merged_methylation_data, 4))| read | family | individual | direction | sequence | sequence_length | quality | modification_types | C+h?_locations | C+h?_probabilities | C+m?_locations | C+m?_probabilities | forward_sequence | forward_quality | forward_C+h?_locations | forward_C+h?_probabilities | forward_C+m?_locations | forward_C+m?_probabilities |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
F1-1a |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
F1-1b |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
F1-1c |
Family 1 |
F1-1 |
reverse |
TCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCTCCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCC |
87 |
@9889C8<<*96;52!*86,227.<I.8AI<>;2/391%D19*5@G=8<7<:!7+;:I:-!03<0AI>9?4!57I*-C#25FD24F; |
C+h?,C+m? |
3,6,15,18,21,30,33,36,45,48,51,60,63,66,69,72,75,78,81,84 |
37,47,64,63,33,64,52,55,17,46,47,64,56,64,56,60,55,58,63,40 |
3,6,15,18,21,30,33,36,45,48,51,60,63,66,69,72,75,78,81,84 |
45,192,126,129,39,129,183,79,19,195,62,124,173,128,84,159,80,165,141,206 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
40,63,58,55,60,56,64,56,64,47,46,17,55,52,64,33,63,64,47,37 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
206,141,165,80,159,84,128,173,124,62,195,19,79,183,129,39,129,126,192,45 |
F1-1d |
Family 1 |
F1-1 |
forward |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
C+h?,C+m? |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
Now, looking at the methylation and hydroxymethylation locations we see that the forward-version locations are 3, 6, 9, 12…, corresponding to the Cs of CGs. This makes the reversed reverse read consistent with the forward reads.
We can now extract the relevant columns and demonstrate that this new
dataframe read from modified FASTQ and metadata CSV is exactly the same
as example_many_sequences.
## Subset to only the columns present in example_many_sequences
merged_methylation_data <- merged_methylation_data[, c("family", "individual", "read", "forward_sequence", "sequence_length", "forward_quality", "forward_C+m?_locations", "forward_C+m?_probabilities", "forward_C+h?_locations", "forward_C+h?_probabilities")]
## Rename "forward_sequence" to "sequence" and same for quality
colnames(merged_methylation_data)[c(4,6:10)] <- c("sequence", "quality", "methylation_locations", "methylation_probabilities", "hydroxymethylation_locations", "hydroxymethylation_probabilities")
## View first 4 rows of data produced from files
print_table(head(merged_methylation_data, 4))| family | individual | read | sequence | sequence_length | quality | methylation_locations | methylation_probabilities | hydroxymethylation_locations | hydroxymethylation_probabilities |
|---|---|---|---|---|---|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
Family 1 |
F1-1 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
Family 1 |
F1-1 |
F1-1c |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
87 |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
206,141,165,80,159,84,128,173,124,62,195,19,79,183,129,39,129,126,192,45 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
40,63,58,55,60,56,64,56,64,47,46,17,55,52,64,33,63,64,47,37 |
Family 1 |
F1-1 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
## View first 4 rows of example_many_sequences
print_table(head(example_many_sequences, 4))| family | individual | read | sequence | sequence_length | quality | methylation_locations | methylation_probabilities | hydroxymethylation_locations | hydroxymethylation_probabilities |
|---|---|---|---|---|---|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
Family 1 |
F1-1 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
Family 1 |
F1-1 |
F1-1c |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
87 |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
206,141,165,80,159,84,128,173,124,62,195,19,79,183,129,39,129,126,192,45 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
40,63,58,55,60,56,64,56,64,47,46,17,55,52,64,33,63,64,47,37 |
Family 1 |
F1-1 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
## Check if equal
identical(merged_methylation_data, example_many_sequences)## [1] TRUE
So, from a modified FASTQ file and the metadata CSV we have successfully
reproduced the example_many_sequences data including
methylation/modification information via read_modified_fastq() and
merge_methylation_with_metadata(). And similarly to before, we can
write back to a modified FASTQ file via write_modified_fastq().
## Use write_modified_fastq with filename = NA and return = TRUE to create
## the FASTQ, but return it as a character vector rather than writing to file.
output_fastq <- write_modified_fastq(
merged_methylation_data,
filename = NA,
return = TRUE,
read_id_colname = "read",
sequence_colname = "sequence",
quality_colname = "quality",
locations_colnames = c("hydroxymethylation_locations",
"methylation_locations"),
probabilities_colnames = c("hydroxymethylation_probabilities",
"methylation_probabilities"),
modification_prefixes = c("C+h?", "C+m?")
)
## View first 16 lines
for (i in 1:16) {
cat(output_fastq[i], "\n")
}## F1-1a MM:Z:C+h?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0;C+m?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0; ML:B:C,26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34,29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## )8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90
## F1-1b MM:Z:C+h?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0;C+m?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0; ML:B:C,10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2,10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## 60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139
## F1-1c MM:Z:C+h?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0;C+m?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0; ML:B:C,40,63,58,55,60,56,64,56,64,47,46,17,55,52,64,33,63,64,47,37,206,141,165,80,159,84,128,173,124,62,195,19,79,183,129,39,129,126,192,45
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## ;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@
## F1-1d MM:Z:C+h?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0;C+m?,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0; ML:B:C,33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55,216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82
## GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA
## +
## :<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0
As with the standard FASTQ, this is not quite identical to the original. That’s because we wrote from the forward-sequence, forward-quality, forward-locations, and forward-probabilities columns (after renaming), so the new FASTQ contains all forward versions. If we wanted the original FASTQ we would just provide colnames for the original sequence, quality, locations, and probabilities rather than the forward versions.
Do be careful that either all of sequence, quality, locations, and probabilities are the forward versions or none are. If they are mismatched then the new FASTQ will be wrong.
ggDNAvis can be used to visualise a single DNA sequence via
visualise_single_sequence(). This function is extremely simple, just
taking a DNA sequence as input. We will use the NOTCH2NLC repeat
expansion sequence of F1-1 from Figure 1 of Sone et al. (2019), but with
some GGCs replaced with GGT so that all four nucleotides are visualised.
## Define sequence variable
sone_2019_f1_1_expanded_ggt_added <- "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGCGGCGGCGGCGGC"
## Use all default settings
visualise_single_sequence(sone_2019_f1_1_expanded_ggt_added)By default, visualise_single_sequence() will return a ggplot object.
It can be useful to view this for instant debugging. However, it is not
usually rendered at a sensible scale or aspect ratio. Therefore, it is
preferable to set a filename = <file_to_write_to.png> for export, as
the function has built-in logic for scaling correctly (with resolution
configurable via the pixels_per_base argument). We don’t have a use
for interactive debugging, so we will also set return = FALSE.
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_01.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "single_sequence_01.png"))This is the typical single sequence visualisation produced by this
package. However, almost every aspect of the visualisation is
configurable via arguments to visualise_single_sequence() (and the
resulting ggplot object can be further modified in standard ggplot
manner if required).
The resolution can be changed with pixels_per_base, but it is
recommended to not go too low otherwise text can become illegible (and
going too high obviously increases filesize). The default value of 100
is often a happy medium.
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_02.png"),
return = FALSE,
pixels_per_base = 20
)
## View image
view_image(paste0(display_location, "single_sequence_02.png"))For all visualise_ functions, the render_device argument can be used
to control the rendering method. It is fed directly to
ggsave(device = ), so the ggsave documentation fully explains its
use. The default ragg::agg_png works well and ensures consistent
graphics (though not font) rendering across platforms/operating systems,
so you should not need to change it.
All of the colours used in the visualisation can be modified with the following arguments:
sequence_colours: A length-4 vector of the colours used for the boxes of A, C, G, and T respectively.sequence_text_colour: The colour used for the A, C, G, and T lettering inside the boxes.index_annotation_colour: The colour used for the index numbers above/below the boxes.background_colour: The colour used for the background.outline_colour: The colour used for the box outlines.
All colour-type arguments should accept colour, color, or col for
the argument name.
For example, we can change all of the colours in an inadvisable way:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_03.png"),
return = FALSE,
sequence_colors = c("black", "white", "#00FFFF", "#00FF00"),
sequence_text_col = "magenta",
index_annotation_colour = "yellow",
background_color = "red",
outline_colour = "orange"
)
## View image
view_image(paste0(display_location, "single_sequence_03.png"))Included in ggDNAvis are a set of colour palettes for sequence colours
that can often be helpful. The default is
sequence_colour_palettes$ggplot_style, as seen in the first example
above. The other palettes are $bright_pale, $bright_pale2,
$bright_deep, $sanger, and $accessible:
The bright_pale palette works well with either white or black text,
depending on how much the text is desired to “pop”:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_04.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale,
sequence_text_colour = "white"
)
## View image
view_image(paste0(display_location, "single_sequence_04.png"))## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_05.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale,
sequence_text_colour = "black"
)
## View image
view_image(paste0(display_location, "single_sequence_05.png"))bright_pale2 is the same but with a slightly lighter shade of green:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_06.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
sequence_text_colour = "black"
)
## View image
view_image(paste0(display_location, "single_sequence_06.png"))The bright_deep palette works best with white text:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_07.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_deep,
sequence_text_colour = "white"
)
## View image
view_image(paste0(display_location, "single_sequence_07.png"))The sanger palette is inspired by old-school Sanger sequencing
readouts and works best with white text:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_08.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$sanger,
sequence_text_colour = "white",
outline_colour = "darkgrey"
)
## View image
view_image(paste0(display_location, "single_sequence_08.png"))The accessible palette is light and dark each of blue and green, which
is the only 4-category qualitative colourblind-safe palette recommended
by colorbrewer2.org (Harrower & Brewer,
2003):
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_09.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$accessible,
sequence_text_colour = "black"
)
## View image
view_image(paste0(display_location, "single_sequence_09.png"))Many aspects of the sequence layout are also customisable via arguments:
line_wrapping: The length/number of bases in each line.spacing: The number of blank lines in between each line of sequence. Must be an integer - this is a fundamental consequence of how the images are rasterised and the whole visualisation logic would need to be re-implemented to allow non-integer spacing values.margin: The margin around the image in terms of the size of base boxes (e.g. the default value of0.5adds a margin half the size of the base boxes, which is 50 px with the defaultpixels_per_base = 100). Note that if index annotations are on, there is a minimum margin of 1 above (if annotations are above) of below (if annotations are below) to allow space to render the annotations, so if margin is set to less than this then it will be increased to 1 in the relevant direction. Also note that if the margin is very narrow it can clip the box outlines, as they are rendered centred on the actual edge of the boxes (i.e. they “spill over” a little to each side if outline linewidth is non-zero), so placing the margin exactly at the box edges will cut half the outlines.sequence_text_size: The size of the text inside the boxes. Can be set to 0 to disable text inside boxes. Defaults to 16.index_annotation_size: The size of the index numbers above/below the boxes. Can be set to0to disable index annotations. Defaults to12.5.index_annotation_interval: The frequency at which index numbers should be listed. Can be set to0to disable index annotations. Defaults to15.index_annotations_above: Boolean specifying whether index annotations should be drawn above or below each line of sequence. Defaults toTRUE(above).index_annotation_vertical_position: How far annotation numbers should be rendered above (ifindex_annotations_above = TRUE) or below (ifindex_annotations_above = FALSE) each base. Defaults to1/3, not recommended to change generally. If spacing is much larger than1, setting this to a slightly higher value might be appropriate.index_annotation_always_first_base: Boolean specifying whether the first base should always be annotated even if it would not usually be (i.e.index_annotation_interval > 1). Defaults toTRUE.index_annotation_always_last_base: Boolean specifying whether the last base should always be annotated even if it would not usually be (i.e.line_length %% index_annotation_interval != 0). Defaults toTRUE.outline_linewidth: The thickness of the box outlines. Can be set to0to disable box outlines. Defaults to3.outline_join: Changes how the corners of the box outlines are handled. Must be one of"mitre","bevel", or"round". Defaults to"mitre". It is unlikely that you would ever need to change this.
A sensible example of how these might be changed is as follows:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_10.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$ggplot_style,
margin = 2,
spacing = 2,
line_wrapping = 60,
index_annotation_interval = 20,
index_annotations_above = FALSE,
index_annotation_vertical_position = 1/2,
index_annotation_always_first_base = FALSE,
index_annotation_always_last_base = FALSE,
outline_linewidth = 0
)
## View image
view_image(paste0(display_location, "single_sequence_10.png"))Setting spacing, margin, sequence text size, and index annotation
interval all to 0 produces a no-frills visualisation of the sequence
only. If doing so, pixels_per_base can be set low as there is no text
that would be rendered poorly at low resolutions:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_11.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale,
margin = 0,
spacing = 0,
line_wrapping = 45,
sequence_text_size = 0,
index_annotation_interval = 0,
pixels_per_base = 20,
outline_linewidth = 5
)## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_first_base setting.
## If you want the first base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_last_base setting.
## If you want the last base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## Warning: If margin is small and outlines are on (outline_linewidth > 0), outlines may be cut off at the edges of the plot. Check if this is happening and consider using a bigger margin.
## Current margin: 0
## View image
view_image(paste0(display_location, "single_sequence_11.png"))
This produced a warning message as setting the margin to 0 clipped off
the outlines of the outermost boxes. Either a slightly larger margin can
be used:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_12.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale,
margin = 0.3,
spacing = 0,
line_wrapping = 45,
sequence_text_size = 0,
index_annotation_interval = 0,
pixels_per_base = 20,
outline_linewidth = 3
)## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_first_base setting.
## If you want the first base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_last_base setting.
## If you want the last base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## View image
view_image(paste0(display_location, "single_sequence_12.png"))Or the outlines can be turned off:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_13.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale,
margin = 0,
spacing = 0,
line_wrapping = 45,
sequence_text_size = 0,
index_annotation_interval = 0,
pixels_per_base = 20,
outline_linewidth = 0
)## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_first_base setting.
## If you want the first base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_last_base setting.
## If you want the last base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## ℹ Automatically using geom_raster (much faster than geom_tile) as no sequence text, index annotations, or outlines are present.
## View image
view_image(paste0(display_location, "single_sequence_13.png"))When changing line wrapping and annotation interval, divisibility is important. It is generally recommended to make the line wrapping length a multiple of the motif length when visualising repeats (e.g. a multiple of 3 for a trinucleotide repeat), and to make the index annotation interval a factor of the line wrapping length. If the annotation interval is not a factor of the line length, then there will be uneven gaps between annotations as the interval is counted from the start of each line.
Here is an example where these guidelines are not followed:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_14.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_deep,
sequence_text_colour = "white",
line_wrapping = 65,
index_annotation_interval = 15
)
## View image
view_image(paste0(display_location, "single_sequence_14.png"))When setting spacing to 0, it is highly recommended to disable index
annotations via index_annotation_interval = 0, otherwise there is
nowhere for them to render:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_15.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$sanger,
sequence_text_colour = "white",
index_annotation_colour = "magenta",
spacing = 0,
outline_colour = "magenta"
)## Warning: Using spacing = 0 without disabling index annotation is not recommended.
## It is likely to draw the annotations overlapping the sequence.
## Recommended to set index_annotation_interval = 0 to disable index annotations.
## View image
view_image(paste0(display_location, "single_sequence_15.png"))The four major visualise functions in ggDNAvis can track the time
taken for each step of the visualisation processing. When the
monitor_performance argument is set to TRUE, the date and timestamp
will be printed along with the function name (obtained via
Sys.time()). Then at the start of each processing step, the time since
the start of the previous step (i.e. the time that the previous step
took) will be printed along with total time since the start of the
function.
For example:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_16.png"),
return = FALSE,
monitor_performance = TRUE
)## ℹ Verbose monitoring enabled
## ℹ (2026-03-06 14:42:01) visualise_single_sequence start
## ℹ (0.004 secs elapsed; 0.004 secs total) resolving aliases
## ℹ (0.001 secs elapsed; 0.005 secs total) validating arguments
## ℹ (0.001 secs elapsed; 0.006 secs total) splitting input seq to sequence vector
## ℹ (0.001 secs elapsed; 0.007 secs total) rasterising image data
## ℹ (0.002 secs elapsed; 0.010 secs total) choosing rendering method
## ℹ (0.001 secs elapsed; 0.011 secs total) calculating tile sizes
## ℹ (0.001 secs elapsed; 0.012 secs total) creating basic plot via geom_tile
## ℹ (0.006 secs elapsed; 0.018 secs total) generating sequence text
## ℹ (0.001 secs elapsed; 0.019 secs total) adding sequence text
## ℹ (0.006 secs elapsed; 0.025 secs total) generating index annotations
## ℹ (0.002 secs elapsed; 0.027 secs total) adding index annotations
## ℹ (0.003 secs elapsed; 0.029 secs total) adding general plot themes
## ℹ (0.009 secs elapsed; 0.039 secs total) calculating margin
## ℹ (0.002 secs elapsed; 0.040 secs total) exporting image file
## ℹ (0.582 secs elapsed; 0.622 secs total) done
## View image
view_image(paste0(display_location, "single_sequence_16.png"))Usually, visualisations in ggDNAvis are drawn via geom_tile(). This
is highly customisable and allows box outlines, text superimposition,
and index annotation. However, for very large datasets, rendering
thousands or millions of tiles can become unusuably slow. A much faster
alternative is geom_raster(), which does not allow for
text/annotations/outlines but can draw much bigger images when needed.
geom_raster() is automatically used when it would not affect the
output image (i.e. when sequence text, annotations, and outlines are
already off), or can be forced by setting force_raster = TRUE.
However, as forcing geom_raster() necessitates removal of
text/annotations/outlines, this produces a warning unless they were all
already turned off.
Furthermore, as geom_raster() only draws simple boxes, a message is
produced if pixels_per_base is greater than 20, as there is not really
any benefit and it increases the file size of the image.
An example where visualise_single_sequence() automatically switches to
geom_raster() and produces a warning for excessive resolution is as
follows:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_17.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_deep,
outline_linewidth = 0,
index_annotation_size = 0,
sequence_text_size = 0,
monitor_performance = TRUE
)## ℹ Verbose monitoring enabled
## ℹ (2026-03-06 14:42:02) visualise_single_sequence start
## ℹ (0.003 secs elapsed; 0.003 secs total) resolving aliases
## ℹ (0.002 secs elapsed; 0.004 secs total) validating arguments
## ℹ Automatically setting index_annotation_interval to 0 as index_annotation_size is 0
## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_first_base setting.
## If you want the first base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_last_base setting.
## If you want the last base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## ℹ (0.003 secs elapsed; 0.008 secs total) splitting input seq to sequence vector
## ℹ (0.001 secs elapsed; 0.009 secs total) rasterising image data
## ℹ (0.003 secs elapsed; 0.012 secs total) choosing rendering method
## ℹ Automatically using geom_raster (much faster than geom_tile) as no sequence text, index annotations, or outlines are present.
## Warning: When using geom_raster, it is recommended to use a smaller pixels_per_base e.g. 10, as there is no text/outlines that would benefit from higher resolution.
## Current value: 100
## ℹ (0.003 secs elapsed; 0.015 secs total) creating basic plot via geom_raster
## ℹ (0.004 secs elapsed; 0.019 secs total) adding general plot themes
## ℹ (0.010 secs elapsed; 0.029 secs total) calculating margin
## ℹ (0.002 secs elapsed; 0.031 secs total) exporting image file
## ℹ (0.925 secs elapsed; 0.956 secs total) done
## View image
view_image(paste0(display_location, "single_sequence_17.png"))An example of forcing rasterisation when there would otherwise be sequence text, index annotations, and outlines (thus producing a warning) is as follows:
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_18.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_deep,
outline_linewidth = 5,
outline_colour = "black",
index_annotation_interval = 3,
index_annotation_size = 12.5,
index_annotation_colour = "darkred",
sequence_text_size = 16,
sequence_text_colour = "white",
force_raster = TRUE,
pixels_per_base = 10,
monitor_performance = TRUE
)## ℹ Verbose monitoring enabled
## ℹ (2026-03-06 14:42:03) visualise_single_sequence start
## ℹ (0.003 secs elapsed; 0.003 secs total) resolving aliases
## ℹ (0.001 secs elapsed; 0.004 secs total) validating arguments
## ℹ (0.001 secs elapsed; 0.005 secs total) splitting input seq to sequence vector
## ℹ (0.001 secs elapsed; 0.006 secs total) rasterising image data
## ℹ (0.002 secs elapsed; 0.008 secs total) choosing rendering method
## Warning: Forcing geom_raster via force_raster = TRUE will remove all sequence
## text, index annotations (though any inserted blank lines/spacers will remain),
## and box outlines.
## ℹ (0.001 secs elapsed; 0.010 secs total) creating basic plot via geom_raster
## ℹ (0.004 secs elapsed; 0.013 secs total) adding general plot themes
## ℹ (0.009 secs elapsed; 0.022 secs total) calculating margin
## ℹ (0.002 secs elapsed; 0.024 secs total) exporting image file
## ℹ (0.126 secs elapsed; 0.150 secs total) done
## View image
view_image(paste0(display_location, "single_sequence_18.png"))If sequence text, annotations, and outlines are all already off
(i.e. sequence_text_size = 0, either index_annotation_size = 0 or
index_annotation_interval = 0, and outline_linewidth = 0), then no
warning is produced from force_raster (but it is redundant and doesn’t
do anything):
## Create image
visualise_single_sequence(
sone_2019_f1_1_expanded_ggt_added,
filename = paste0(output_location, "single_sequence_19.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_deep,
outline_linewidth = 0,
index_annotation_interval = 0,
sequence_text_size = 0,
pixels_per_base = 10,
force_raster = TRUE,
monitor_performance = TRUE
)## ℹ Verbose monitoring enabled
## ℹ (2026-03-06 14:42:03) visualise_single_sequence start
## ℹ (0.003 secs elapsed; 0.003 secs total) resolving aliases
## ℹ (0.001 secs elapsed; 0.004 secs total) validating arguments
## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_first_base setting.
## If you want the first base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## Warning: Disabling index annotations via index_annotation_interval = 0 or index_annotation_size = 0 overrides the index_annotation_always_last_base setting.
## If you want the last base in each line to be annotated but no other bases, set index_annotation_interval greater than line_wrapping.
## ℹ (0.002 secs elapsed; 0.006 secs total) splitting input seq to sequence vector
## ℹ (0.005 secs elapsed; 0.011 secs total) rasterising image data
## ℹ (0.003 secs elapsed; 0.014 secs total) choosing rendering method
## ℹ Automatically using geom_raster (much faster than geom_tile) as no sequence text, index annotations, or outlines are present.
## ℹ (0.003 secs elapsed; 0.017 secs total) creating basic plot via geom_raster
## ℹ (0.004 secs elapsed; 0.021 secs total) adding general plot themes
## ℹ (0.010 secs elapsed; 0.031 secs total) calculating margin
## ℹ (0.003 secs elapsed; 0.034 secs total) exporting image file
## ℹ (0.123 secs elapsed; 0.157 secs total) done
## View image
view_image(paste0(display_location, "single_sequence_19.png"))ggDNAvis can be used to visualise multiple DNA sequences via
visualise_many_sequences(). This function takes a vector of sequences
as its primary input, which do not all have to be the same length and
can be blank for spacing lines. This can be constructed manually
e.g. c("GGCGGCGGC", "", "TTATTA"), but is more easily produced by
extract_and_sort_sequences().
Here is an example of how that could be accomplished with the
example_many_sequences data, with a reminder of how to load
sequence/quality data from FASTQ and merge with metadata (as fully
explained in the reading standard FASTQ section):
## Reminder of how to load data from file
fastq_data <- read_fastq(
system.file("extdata/example_many_sequences_raw.fastq", package = "ggDNAvis"),
calculate_length = TRUE
)
metadata <- read.csv(system.file("extdata/example_many_sequences_metadata.csv", package = "ggDNAvis"))
merged_fastq_data <- merge_fastq_with_metadata(fastq_data, metadata)
## Subset and change colnames to make it match example_many_sequences
merged_fastq_data <- merged_fastq_data[, c("family", "individual", "read", "forward_sequence", "sequence_length", "forward_quality")]
colnames(merged_fastq_data)[c(4,6)] <- c("sequence", "quality")
## Prove equivalance to example_many_sequences
identical(merged_fastq_data, example_many_sequences[, 1:6])## [1] TRUE
## Look at first 4 rows of the data as a reminder
print_table(head(merged_fastq_data, 4))| family | individual | read | sequence | sequence_length | quality |
|---|---|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
Family 1 |
F1-1 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
Family 1 |
F1-1 |
F1-1c |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
87 |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
Family 1 |
F1-1 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
## Extract sequences to a character vector
sequences_for_visualisation <- extract_and_sort_sequences(merged_fastq_data)
## View the character vector
sequences_for_visualisation## [1] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [2] "GGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [3] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [4] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [5] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [6] ""
## [7] ""
## [8] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGA"
## [9] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGA"
## [10] ""
## [11] ""
## [12] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [13] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGA"
## [14] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGCGGA"
## [15] ""
## [16] ""
## [17] ""
## [18] ""
## [19] ""
## [20] ""
## [21] ""
## [22] ""
## [23] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [24] ""
## [25] ""
## [26] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [27] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [28] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [29] ""
## [30] ""
## [31] ""
## [32] ""
## [33] ""
## [34] ""
## [35] ""
## [36] ""
## [37] "GGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [38] "GGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [39] ""
## [40] ""
## [41] "GGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [42] "GGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGA"
## [43] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGCGGCGGA"
## [44] ""
## [45] ""
## [46] "GGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [47] ""
## [48] ""
## [49] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [50] "GGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGCGGA"
## [51] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGCGGCGGA"
## Use the character vector to make the image
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_01.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "many_sequences_01.png"))The extract_and_sort_sequences() function is highly configurable to
change the arrangement and spacing of the sequences.
It takes the following arguments:
sequence_dataframe: The data to be processedsequence_variable: The name of the column we are extracting. This doesn’t actually have to be a sequence, it could be any information that we want to convert into a sorted vector spaced out with empty strings.grouping_levels: How the data should be grouped. This is a named numerical vector stating which variables/columns should be used to group the data, and how many lines should be left between groups at each level. For example, the defaultc("family" = 8, "individual" = 2)means the top-level grouping is done by categories in the"family"column and there are 8 blank lines between each family, and the second-level grouping is done by the"individual"column and there are 2 blank lines between individuals within the same family. This is implemented recursively, so any number of grouping variables can be used (or this can be set toNAto turn off grouping entirely).sort_by: The name of the column used to sort sequences within the lowest-level groups. This is generally the sequence length (but doesn’t have to be).desc_sort: Whether the sequences should be sorted by thesort_byvariable descending (desc_sort = TRUE) or (desc_sort = FALSE).
The image above used all the default values, which are set up to work
with the columns present in example_many_sequences and use the
families-separated-by-8, individuals-separated-by-2 grouping and
arranged sequences in descending length order.
Here is the same image but with the default arguments explicitly stated:
## Extract sequences to a character vector
## Remember that example_many_sequences is identical to the data
## read from FASTQ and metadata CSV in the previous code section
sequences_for_visualisation <- extract_and_sort_sequences(
example_many_sequences,
sequence_variable = "sequence",
grouping_levels = c("family" = 8,
"individual" = 2),
sort_by = "sequence_length",
desc_sort = TRUE
)
## We will not view the character vector in the interests of avoiding clutter.
## Use the character vector to make the image
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_02.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "many_sequences_02.png"))Here the top large cluster is Family 1, containing individuals F1-1, F1-2, and F-3. These individuals contain 5, 2, and 3 reads respectively, and are separated from each other by 2 blank lines. After Family 1, there is there 8 blank lines before Family 2. Family 2 contains F2-1 and F2-2 with 1 and 3 reads (individuals separated by 2 blank lines), then there are 8 blank lines before Family 3. Family 3 contains F3-1, F3-2, F3-3, and F3-4 with 2, 3, 1, and 3 reads.
If we wanted to group only by individual without showing the family structure, and present reads in ascending length order for each individual, we could do the following:
## Extract sequences to a character vector
sequences_for_visualisation <- extract_and_sort_sequences(
example_many_sequences,
sequence_variable = "sequence",
grouping_levels = c("individual" = 1),
sort_by = "sequence_length",
desc_sort = FALSE
)
## Use the character vector to make the image
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_03.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "many_sequences_03.png"))Now we have a group for each individual, with sequences in ascending length order per individual, and one blank line between individuals.
We could also turn off grouping entirely to just visualise all of the
reads in length order, via grouping_levels = NA:
## Extract sequences to a character vector
sequences_for_visualisation <- extract_and_sort_sequences(
example_many_sequences,
sequence_variable = "sequence",
grouping_levels = NA,
sort_by = "sequence_length",
desc_sort = TRUE
)
## Use the character vector to make the image
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_04.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "many_sequences_04.png"))We can also turn off sorting entirely (keeping grouping off) with
sort_by = NA to simply show all the reads in the order in which they
appear in the dataframe:
NB: if sort_by = NA is used, then desc_sort does nothing so it
doesn’t matter what it is set to.
## Extract sequences to a character vector
sequences_for_visualisation <- extract_and_sort_sequences(
example_many_sequences,
sequence_variable = "sequence",
grouping_levels = NA,
sort_by = NA
)
## Use the character vector to make the image
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_05.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "many_sequences_05.png"))It is also possible to keep grouping on while turning sorting off if desired:
## Extract sequences to a character vector
sequences_for_visualisation <- extract_and_sort_sequences(
example_many_sequences,
sequence_variable = "sequence",
grouping_levels = c("family" = 2,
"individual" = 1),
sort_by = NA
)
## Use the character vector to make the image
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_06.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "many_sequences_06.png"))The grouping spacers can be set to 0 to sort within groups without
visually separating them (but negative values don’t work - they produce
an error in rep() as the blank line can’t be repeated a negative
number of times). Additionally, the order of the groups/levels within a
grouping variable can be changed in standard R fashion with
factor(x, levels = ...):
## Reorder families
example_many_sequences_reordered <- example_many_sequences
example_many_sequences_reordered$family_reordered <- factor(
example_many_sequences_reordered$family,
levels = c("Family 2",
"Family 3",
"Family 1")
)
## Extract sequences to a character vector
sequences_for_visualisation <- extract_and_sort_sequences(
example_many_sequences_reordered,
sequence_variable = "sequence",
grouping_levels = c("family_reordered" = 0),
sort_by = "sequence_length"
)
## Use the character vector to make the image
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_07.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "many_sequences_07.png"))Finally, all the same grouping and sorting logic can be used to extract
any other column as a character vector, though of course if it isn’t DNA
sequence then the resulting vector is not valid input to
visualise_many_sequences(). The column for extraction is specified by
sequence_variable, and the column for sorting is sort_by. If the
sort_by column is non-numeric then it will be sorted alphabetically,
just like using sort() on a character vector.
## Extract qualities to character vector,
## sorted alphabetically by quality string
extracted_and_sorted_qualities <- extract_and_sort_sequences(
example_many_sequences,
sequence_variable = "quality",
grouping_levels = c("family" = 2),
sort_by = "quality",
desc_sort = FALSE
)
## View character vector
print(extracted_and_sorted_qualities, quote = F)## [1] )8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90
## [2] *46.5//3:37?24:(:0*#.))E)?:,/172=2!4">.*/;"8+5<;D6.I2=>:C3)108,<)GC161)!55E!.>86/
## [3] 60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139
## [4] 736/A@B121C269<2I,'5G66>46A6-9*&4*;4-E4C429?I+3@83(234E0%:43;!/3;2+956A0)(+'5G4=*3;1
## [5] :<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0
## [6] ;4*2E3-48?@6A-!00!;-3%:H,4H>H530C(85I/&75-62.:2#!/D=A?8&7E!-@:=::5,)51,97D*04'2.!20@/;6)947<6
## [7] ;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@
## [8] ?;.*26<C-8B,3#8/,-9!1++:94:/!A317=9>502=-+8;$=53@D*?/6:6&0D7-.@8,5;F,1?0D?$9'&665B8.604
## [9] E6(<)"-./EE<(5:47,(C818I9CC1=.&)4G6-7<(*"(,2C>8/5:0@@).A$97I!-<
## [10] F='I#*5I:<F?)<4G3&:95*-5?1,!:9BD4B5.-27577<2E9)2:189B.5/*#7;;'**.7;-!
## [11]
## [12]
## [13] 7?38,EC#3::=1)8&;<">3.9BE)1661!2)5-4.11B<3)?')-+,B4.<7)/:IE=5$.3:66G9216-C20,>(0848(1$-
## [14] ;1>:5417*<1.2H#260197.;7<(-3?0+=:)ID'I$6*128*!4.7-=5;+384F!=5>4!93+.6I7+H1-).H><68;7
## [15] =</-I354/,*>+<CA40*537/;<@I7/4%6192'5'>#4:&C,072+90:0+4;74"D5,38&<7A?00+1>G>#=?;,@<<1=64D=!1&
## [16] @86,/+6=8/;9=1)48E494IB3456/6.*=</B32+5469>8?@!1;*+81$>-99D7<@1$6B'?462?CE+=1+95=G?.6CA%>2
## [17]
## [18]
## [19] $<,5"7+!$';8<0794*@FI>34224!57+#1!F<+53$,?)-.A3;=1*71C02<.5:1)82!86$03/;%+1C3+D3;@9B-E#+/70;9<D'
## [20] .85$#;!1F$8E:B+;7CI6@11/'65<3,4G:8@GF1413:0)3CH1=44.%G=#2E67=?;9DF7358.;(I!74:1I4
## [21] /*2<C643?*8?@9)-.'5A!=3-=;6,.%H3-!10'I>&@?;96;+/+36;:C;B@/=:6,;61>?>!,>.97@.48B38(;7;1F464=-7;)7
## [22] /C<$>7/1(9%4:6>6I,D%*,&D?C/6@@;7)83.E.7:@9I906<!4536!850!164/8,<=?=15A;8B/5B364A66.1%9=(9876E8C:
## [23] 0/2>@/6+-/(!=9-?G!AA70*,/!/?-E46:,-1G94*491,,38?(-!6<8A;/C9;,3)4C06=%',86A)1!E@/24G59<<
## [24] 5@<733';9+3BB)=69,3!.2B*86'8E>@3?!(36:<002/4>:1.43A!+;<.3G*G8?0*991,B(C/"I9*1-86)8.;;5-0+=
## [25] 9>124!752+@06I/.72097*';-+A60=B?+/8'15477>4-435D;G@G'./21:(0/1/A=7'I>A"3=9;;12,@"2=3D=,458
## [26] :0I4099<,4E01;/@96%2I2<,%<C&=81F+4<*@4A5.('4!%I3CE657<=!5;37>4D:%3;7'"4<.9;?;7%0>:,84B512,B7/
## [27] ?2-#-2"1:(5(4>!I)>I,.?-+EG3IH4-.C:;570@2I;?D5#/;A7=>?<3?080::459*?8:3"<2;I)C1400)6:3%19./);.I?35
This extracted the quality column, with families separated by 2 blank
strings, and sorted alphabetically by quality string within each family.
As of ggDNAvis v1.0.0, visualise_many_sequences() (and
visualise_methylation()) support index annotation. This is implemented
differently to visualise_single_sequence() because each line
represents a different sequence/read, so it would not make sense to
maintain a single base count. Instead, base indices are counted along
each line and reset for each new line. To reduce redundancy, it is
user-configurable which lines are annotated.
The full set of arguments controlling index annotations are:
index_annotation_lines: This is a key argument to change. Controls which lines should have their indices annotated. Defaults to1i.e. only the first line will be annotated. Can be set to1:length(sequences_vector)to annotate all lines, or to a custom integer vector to annotate specific lines. With the default argument values ofextract_and_sort_sequences(),c(1, 23, 37)annotates the first sequence from each family, which I personally find a useful setting. It may take some trial and error to find the ideal setting of this for each ordering/dataset. Can be set to0,FALSE,NA,NULL, ornumeric(0)to disable index annotations.index_annotation_full_line: Whether the annotations should always continue to the end of the longest sequence (TRUE, default) or whether they should end once the sequence along each annotated line ends (FALSE).index_annotation_colour: The colour used for the index numbers above/below the boxes. Defaults to dark red.index_annotation_size: The size of the index numbers above/below the boxes. Can be set to0to disable index annotations. Defaults to12.5.index_annotation_interval: The frequency at which index numbers should be listed. Defaults to15. Note that unlikevisualise_single_sequence(), the count resets each line invisualise_many_sequences()andvisualise_methylation()because each line is assumed to be a different sequence.index_annotations_above: Boolean specifying whether index annotations should be drawn above or below each line of sequence. Defaults toTRUE(above).index_annotation_always_first_base: Boolean specifying whether the first base should always be annotated even if it would not usually be (i.e.index_annotation_interval > 1). Defaults toTRUE. Note that this only applies to lines where annotations would be drawn, so not if they are excluded byindex_annotation_linesor disabled viaindex_annotation_interval = 0orindex_annotation_size = 0. If the goal is to annotate the first base and no others in each line, turn this on but setindex_annotation_intervalto a value greater than the maximum sequence length.index_annotation_always_last_base: Boolean specifying whether the last base should always be annotated even if it would not usually be (i.e.line_length %% index_annotation_interval != 0). Defaults toTRUE.index_annotation_vertical_position: How far annotation numbers should be rendered above (ifindex_annotations_above = TRUE) or below (ifindex_annotations_above = FALSE) each base. Defaults to1/3, not recommended to change generally.
We will work through these arguments step by step to fully explain how they work.
By default, annotations are drawn above the first line:
## Extract sequences to a character vector, using all default settings
sequences_for_visualisation <- extract_and_sort_sequences(example_many_sequences)
## Use the character vector to make the image
## index_annotation_lines = c(1) is the default value
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_08.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_lines = c(1)
)
## View image
view_image(paste0(display_location, "many_sequences_08.png"))However, any numerical vector can be used as index_annotation_lines to
specify which lines should be annotated. For each selected line, an
additional blank/spacer line will be inserted above (if
index_annotations_above = TRUE) or below (if
index_annotations_below = FALSE), and index annotations will be drawn
in the new space.
(Note: if index_annotation_vertical_position is more than 1, more
than 1 additional blank line will be inserted, according to
ceiling(index_annotation_vertical_position)).
Annotating above each line would look as follows:
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_09.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_lines = c(1:51)
)
## View image
view_image(paste0(display_location, "many_sequences_09.png"))To annotate below the final line of each family, we can look at the sequences vector:
sequences_for_visualisation## [1] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [2] "GGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [3] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [4] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [5] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [6] ""
## [7] ""
## [8] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGA"
## [9] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGA"
## [10] ""
## [11] ""
## [12] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [13] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGA"
## [14] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGCGGA"
## [15] ""
## [16] ""
## [17] ""
## [18] ""
## [19] ""
## [20] ""
## [21] ""
## [22] ""
## [23] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [24] ""
## [25] ""
## [26] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [27] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [28] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [29] ""
## [30] ""
## [31] ""
## [32] ""
## [33] ""
## [34] ""
## [35] ""
## [36] ""
## [37] "GGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [38] "GGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [39] ""
## [40] ""
## [41] "GGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [42] "GGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGA"
## [43] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGCGGCGGA"
## [44] ""
## [45] ""
## [46] "GGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [47] ""
## [48] ""
## [49] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [50] "GGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGCGGA"
## [51] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGCGGCGGA"
We can see that lines 14, 28, and 51 are the last sequence in each family, so we will annotate below those lines (and also enable annotating the first base in each line):
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_10.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_lines = c(14, 28, 51),
index_annotations_above = FALSE,
index_annotation_always_first_base = TRUE
)
## View image
view_image(paste0(display_location, "many_sequences_10.png"))As with visualise_single_sequence(), the frequency of annotations
along each line is controlled by index_annotation_interval.
Additionally, it is configurable whether annotations continue to the end
of the image (index_annotation_full_line = TRUE, default) or stop when
each annotated sequence ends (index_annotation_full_line = FALSE).
Annotating above every line every 3 bases until each sequence ends would look as follows:
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_11.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_lines = c(1:51),
index_annotations_above = TRUE,
index_annotation_interval = 3,
index_annotation_full_line = FALSE
)
## View image
view_image(paste0(display_location, "many_sequences_11.png"))And doing the same but annotating until the end of the image regardless of when each sequence ends would look as follows:
Note that the blank/spacing lines are also annotated, but with
index_annotation_full_line = FALSE they don’t display anything as
there is no sequence (however, the additional spacers are still inserted
to make room for theoretical annotations).
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_12.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_lines = c(1:51),
index_annotations_above = TRUE,
index_annotation_interval = 3,
index_annotation_full_line = TRUE
)
## View image
view_image(paste0(display_location, "many_sequences_12.png"))Customising the colour, size, and vertical position of annotations works
exactly the same as visualise_single_sequence() via
index_annotation_colour, index_annotation_size, and
index_annotation_vertical_position respectively:
(if you make the text much bigger than this then the margin will also
need increasing to prevent the top of the text being cut off).
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_13.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_lines = c(1, 23, 37),
index_annotations_above = TRUE,
index_annotation_interval = 6,
index_annotation_full_line = TRUE,
index_annotation_always_first_base = TRUE,
index_annotation_colour = "green",
index_annotation_size = 30,
index_annotation_vertical_position = 1.5
)
## View image
view_image(paste0(display_location, "many_sequences_13.png"))Finally, index annotations can of course also be turned completely off
if desired. The ‘canonical’ way of doing this is by setting
index_annotation_lines = NA or index_annotation_lines = numeric(0),
but index_annotation_size = 0 and index_annotation_interval = 0 also
work perfectly well:
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_14.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_lines = NA
)
## View image
view_image(paste0(display_location, "many_sequences_14.png"))visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_15.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_interval = 0
)## ℹ Automatically emptying index_annotation_lines as index_annotation_interval is 0
## View image
view_image(paste0(display_location, "many_sequences_15.png"))visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_16.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
index_annotation_size = 0
)## ℹ Automatically emptying index_annotation_lines as index_annotation_size is 0
## View image
view_image(paste0(display_location, "many_sequences_16.png"))As with visualise_single_sequence(), colours in
visualise_many_sequences() are highly customisable and can use the
various palettes from sequence_colour_palettes. Additionally, margin,
resolution, and text size are customisable (including turning text off
by setting size to 0).
Colour-related arguments:
sequence_colours: A length-4 vector of the colours used for the boxes of A, C, G, and T respectively.sequence_text_colour: The colour used for the A, C, G, and T lettering inside the boxes.index_annotation_colour: The colour used for the index numbers above/below the boxes.background_colour: The colour used for the background.outline_colour: The colour used for the box outlines.
Layout-related arguments:
margin: The margin around the image in terms of the size of base boxes (e.g. the default value of0.5adds a margin half the size of the base boxes, which is 50 px with the defaultpixels_per_base = 100).sequence_text_size: The size of the text inside the boxes. Can be set to0to disable text inside boxes. Defaults to16.index_annotation_size: The size of the index numbers above/below the boxes. Can be set to0to disable index annotations. Defaults to12.5.outline_linewidth: The thickness of the box outlines. Can be set to0to disable box outlines. Defaults to3.outline_join: Changes how the corners of the box outlines are handled. Must be one of"mitre","bevel", or"round". Defaults to"mitre". It is unlikely that you would ever need to change this.pixels_per_base: Resolution, as determined by number of pixels in the side length of one DNA base square. Everything else is scaled proportionally. Defaults to100(sensible for text, but can be set lower e.g.10or20if text is turned off).render_device: The deviceggsaveshould use to render the plot. Defaults toragg::agg_png, not recommended to change. Can be set toNULLto infer device based onfilenameextension.
All colour-type arguments should accept colour, color, or col for
the argument name.
For example, a layout with increased margins, enlarged text, and crazy colours might be:
## Extract sequences to a character vector
sequences_for_visualization <- extract_and_sort_sequences(example_many_sequences)
## Use the character vector to make the image
visualize_many_sequences(
sequences_for_visualization,
filename = paste0(output_location, "many_sequences_17.png"),
return = FALSE,
sequence_colors = c("orange", "#00FF00", "magenta", "black"),
sequence_text_col = "cyan",
index_annotation_colour = "purple",
background_color = "yellow",
outline_col = "red",
outline_join = "round",
outline_linewidth = 15,
sequence_text_size = 40,
index_annotation_lines = c(1, 11, 21, 31, 41, 51),
index_annotation_full_line = TRUE,
index_annotation_interval = 5,
index_annotations_above = FALSE,
index_annotation_size = 25,
margin = 5
)
## View image
view_image(paste0(display_location, "many_sequences_17.png"))As with visualise_single_sequence(), text can be turned off, in which
case it is sensible to reduce the resolution:
## Extract sequences to a character vector
sequences_for_visualisation <- extract_and_sort_sequences(
example_many_sequences,
grouping_levels = c("family" = 4,
"individual" = 1)
)
## Use the character vector to make the image
visualise_many_sequences(
sequences_for_visualisation,
filename = paste0(output_location, "many_sequences_18.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$bright_pale2,
sequence_text_size = 0,
index_annotation_size = 0,
margin = 0.1,
pixels_per_base = 20
)## Warning: If margin is small and outlines are on (outline_linewidth > 0),
## outlines may be cut off at the edges of the plot. Check if this is happening
## and consider using a bigger margin.
## ℹ Automatically emptying index_annotation_lines as index_annotation_size is 0
## View image
view_image(paste0(display_location, "many_sequences_18.png"))
Note that the margin/outline warning is produced whenever the margin is
≤0.25 and the outline linewidth is >0. Getting the warning does not
necessarily mean that the outlines are getting cut off (as this only
happens if the half of the outline that falls outside the boxes is
thicker than the margin), but if you get the warning you should check.
In this case it’s fine and the outlines are not getting cut off with 0.1
margin.
As with visualise_single_sequence(), visualise_many_sequences()
primarily uses geom_tile() but can use the faster geom_raster() if
the bells and whistles are not required. This is fully explained in
visualise_single_sequence() performance, but the
following differences apply here:
For visualise_many_sequences(), geom_raster() is automatically used
if:
sequence_text_sizeis0,index_annotation_linesisNAornumeric(0), orindex_annotation_intervalis0, orindex_annotation_sizeis0, andoutline_linewidthis0
For example:
sequences <- extract_and_sort_sequences(example_many_sequences)
visualise_many_sequences(
sequences,
filename = paste0(output_location, "many_sequences_19.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$sanger,
sequence_text_size = 0,
index_annotation_lines = NA,
outline_linewidth = 0,
pixels_per_base = 20,
monitor_performance = TRUE
)## ℹ Verbose monitoring enabled
## ℹ (2026-03-06 14:42:32) visualise_many_sequences start
## ℹ (0.003 secs elapsed; 0.003 secs total) resolving aliases
## ℹ (0.001 secs elapsed; 0.005 secs total) validating arguments
## ℹ (0.005 secs elapsed; 0.010 secs total) inserting blank sequences at specified indices
## ℹ (0.002 secs elapsed; 0.011 secs total) rasterising image data
## ℹ (0.008 secs elapsed; 0.019 secs total) choosing rendering method
## ℹ Automatically using geom_raster (much faster than geom_tile) as no sequence text, index annotations, or outlines are present.
## ℹ (0.003 secs elapsed; 0.022 secs total) creating basic plot via geom_raster
## ℹ (0.004 secs elapsed; 0.027 secs total) adding general plot themes
## ℹ (0.011 secs elapsed; 0.037 secs total) calculating margin
## ℹ (0.002 secs elapsed; 0.040 secs total) exporting image file
## ℹ (0.498 secs elapsed; 0.538 secs total) done
## View image
view_image(paste0(display_location, "many_sequences_19.png"))One important thing to note (which also applies to
visualise_methylation()) is that if force_raster is set to TRUE,
the index annotation text will not be drawn, but the blank rows inserted
to make room for it will still be inserted (see index annotation
customisation for how blank rows
are inserted). This means the outcome is not identical between forcing
geom_raster() and allowing it to be automatically applied by manually
turning off text/annotations/outlines:
visualise_many_sequences(
sequences,
filename = paste0(output_location, "many_sequences_20.png"),
return = FALSE,
sequence_colours = sequence_colour_palettes$sanger,
index_annotation_lines = 1:51,
pixels_per_base = 20,
force_raster = TRUE,
monitor_performance = TRUE
)## ℹ Verbose monitoring enabled
## ℹ (2026-03-06 14:42:33) visualise_many_sequences start
## ℹ (0.006 secs elapsed; 0.006 secs total) resolving aliases
## ℹ (0.002 secs elapsed; 0.008 secs total) validating arguments
## ℹ (0.001 secs elapsed; 0.009 secs total) inserting blank sequences at specified indices
## ℹ (0.001 secs elapsed; 0.011 secs total) rasterising image data
## ℹ (0.009 secs elapsed; 0.019 secs total) choosing rendering method
## Warning: Forcing geom_raster via force_raster = TRUE will remove all sequence
## text, index annotations (though any inserted blank lines/spacers will remain),
## and box outlines.
## ℹ (0.002 secs elapsed; 0.021 secs total) creating basic plot via geom_raster
## ℹ (0.004 secs elapsed; 0.025 secs total) adding general plot themes
## ℹ (0.010 secs elapsed; 0.035 secs total) calculating margin
## ℹ (0.002 secs elapsed; 0.037 secs total) exporting image file
## ℹ (0.251 secs elapsed; 0.288 secs total) done
## View image
view_image(paste0(display_location, "many_sequences_20.png"))When basecalling Oxford Nanopore sequencing data in Guppy or Dorado, modified basecalling can be enabled. This means the resulting BAM file contains information on DNA modifications as well as the sequence information. Most commonly, the modification assessed is 5-cytosine-methylation at CpG sites (5’-CG-3’ dinucleotides).
The modification information is stored in the MM and ML tags of the BAM file. It can then be written to the header row of a FASTQ file via:
samtools fastq -T MM,ML ${input_bam_file} > "modified_fastq_file.fastq"This is all discussed in more detail in the reading from modified FASTQ section.
As a reminder, methylation information can be read from FASTQ as follows:
modified_fastq_data <- read_modified_fastq(system.file("extdata/example_many_sequences_raw_modified.fastq", package = "ggDNAvis"))
metadata <- read.csv(system.file("extdata/example_many_sequences_metadata.csv", package = "ggDNAvis"))
## Merge with offset = 1 (map C to C of palindromic CG sites when reversing)
## See the reading from modified FASTQ section for a full discussion
merged_modification_data <- merge_methylation_with_metadata(modified_fastq_data, metadata,
reversed_location_offset = 1)
## Subset and change colnames to make it match example_many_sequences
merged_modification_data <- merged_modification_data[, c("family", "individual", "read", "forward_sequence", "sequence_length", "forward_quality", "forward_C+m?_locations", "forward_C+m?_probabilities", "forward_C+h?_locations", "forward_C+h?_probabilities")]
colnames(merged_modification_data)[c(4,6:10)] <- c("sequence", "quality", "methylation_locations", "methylation_probabilities", "hydroxymethylation_locations", "hydroxymethylation_probabilities")
## Prove equivalance to example_many_sequences
identical(merged_modification_data, example_many_sequences)## [1] TRUE
## Look at first 4 rows of the data as a reminder
print_table(head(merged_modification_data, 4))| family | individual | read | sequence | sequence_length | quality | methylation_locations | methylation_probabilities | hydroxymethylation_locations | hydroxymethylation_probabilities |
|---|---|---|---|---|---|---|---|---|---|
Family 1 |
F1-1 |
F1-1a |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
102 |
)8@!9:/0/,0+-6?40,-I601:.';+5,@0.0%)!(20C*,2++*(00#/*+3;E-E)<I5.5G*CB8501;I3'.8233'3><:13)48F?09*>?I90 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99 |
26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34 |
Family 1 |
F1-1 |
F1-1b |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
63 |
60-7,7943/*=5=)7<53-I=G6/&/7?8)<$12">/2C;4:9F8:816E,6C3*,1-2139 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253 |
3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60 |
10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2 |
Family 1 |
F1-1 |
F1-1c |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
87 |
;F42DF52#C-*I75!4?9>IA0<30!-:I:;+7!:<7<8=G@5*91D%193/2;><IA8.I<.722,68*!25;69*<<8C9889@ |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
206,141,165,80,159,84,128,173,124,62,195,19,79,183,129,39,129,126,192,45 |
3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84 |
40,63,58,55,60,56,64,56,64,47,46,17,55,52,64,33,63,64,47,37 |
Family 1 |
F1-1 |
F1-1d |
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA |
81 |
:<*1D)89?27#8.3)9<2G<>I.=?58+:.=-8-3%6?7#/FG)198/+3?5/0E1=D9150A4D//650%5.@+@/8>0 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82 |
3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78 |
33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55 |
Once we have the dataframe with all forward modification columns, we can
extract and sort them with extract_and_sort_methylation(). This
function works extremely similarly to extract_and_sort_sequences() (as
explained with examples previously in the many sequences arrangement
customisation section), but
instead of taking a single argument for the sequence column to extract,
it takes four arguments for locations, probabilities, sequences, and
sequence length colnames to extract:
## Extract locations, probabilities, and lengths
## Remember that example_many_sequences is identical to merged_modification_data
methylation_data_for_visualisation <- extract_and_sort_methylation(
example_many_sequences,
locations_colname = "methylation_locations",
probabilities_colname = "methylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = c("family" = 8, "individual" = 2),
sort_by = "sequence_length",
desc_sort = TRUE
)
methylation_data_for_visualisation## $locations
## [1] "3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99"
## [2] "3,6,9,12,15,18,27,30,33,42,45,48,57,60,63,72,75,78,87,90"
## [3] "3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84"
## [4] "3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78"
## [5] "3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60"
## [6] ""
## [7] ""
## [8] "3,6,9,12,15,18,21,24,27,30,33,36,48,51,63,66"
## [9] "3,6,9,12,15,18,21,24,27,30,42,45,57,60"
## [10] ""
## [11] ""
## [12] "3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84"
## [13] "3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,78,81"
## [14] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,54,57,60,69,72,75,78"
## [15] ""
## [16] ""
## [17] ""
## [18] ""
## [19] ""
## [20] ""
## [21] ""
## [22] ""
## [23] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,87,90"
## [24] ""
## [25] ""
## [26] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,84,87"
## [27] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,81,84"
## [28] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,78,81"
## [29] ""
## [30] ""
## [31] ""
## [32] ""
## [33] ""
## [34] ""
## [35] ""
## [36] ""
## [37] "3,6,9,18,21,30,33,42,45,54,57,66,69,78,81,90,93"
## [38] "3,6,9,12,15,18,21,30,33,42,45,54,57,66,69,78,81,90,93"
## [39] ""
## [40] ""
## [41] "3,6,9,12,15,18,27,30,39,42,51,54,63,66,75,78,87,90"
## [42] "3,6,9,12,15,18,27,30,39,42,51,54,63,66,75,78,87"
## [43] "3,6,9,12,15,18,21,24,27,30,39,42,51,54,63,66,75,78,81,84"
## [44] ""
## [45] ""
## [46] "3,6,9,12,15,18,21,30,33,42,45,54,57,66,69,78,81,90,93"
## [47] ""
## [48] ""
## [49] "3,6,9,12,15,18,21,24,27,30,33,42,45,54,57,66,69,78,81,90,93"
## [50] "3,6,9,12,15,18,21,24,33,36,45,48,57,60,69,72,81,84,87"
## [51] "3,6,9,12,15,18,21,24,27,30,33,36,45,48,57,60,69,72,75,78"
##
## $probabilities
## [1] "29,159,155,159,220,163,2,59,170,131,177,139,72,235,75,214,73,68,48,59,81,77,41"
## [2] "170,236,120,36,139,50,229,99,79,41,229,42,230,34,34,27,130,77,7,79"
## [3] "206,141,165,80,159,84,128,173,124,62,195,19,79,183,129,39,129,126,192,45"
## [4] "216,221,11,81,4,61,180,79,130,13,144,31,228,4,200,23,132,98,18,82"
## [5] "10,56,207,134,233,212,12,116,68,78,129,46,194,51,66,253"
## [6] ""
## [7] ""
## [8] "31,56,233,241,71,31,203,190,234,254,240,124,72,64,128,127"
## [9] "189,9,144,71,52,34,83,40,33,111,10,182,26,242"
## [10] ""
## [11] ""
## [12] "81,245,162,32,108,233,119,232,152,161,222,128,251,83,123,91,160,189,144,250"
## [13] "149,181,109,88,194,108,143,30,77,122,88,153,19,244,6,215,161,79,189"
## [14] "147,112,58,21,217,60,252,153,255,96,142,110,147,110,57,22,163,110,19,205,83,193"
## [15] ""
## [16] ""
## [17] ""
## [18] ""
## [19] ""
## [20] ""
## [21] ""
## [22] ""
## [23] "163,253,33,225,207,210,213,187,251,163,168,135,81,196,134,187,78,103,52,251,144,71,47,193,145,238,163,179"
## [24] ""
## [25] ""
## [26] "191,91,194,96,204,7,129,209,139,68,88,94,109,234,200,188,72,116,73,178,209,167,105,243,62,155,193"
## [27] "176,250,122,197,146,246,203,136,152,67,71,17,144,67,1,150,133,215,8,153,68,31,26,191,4,13"
## [28] "122,217,108,8,66,85,34,127,205,86,130,126,203,145,27,206,145,54,191,78,125,252,108,62,55"
## [29] ""
## [30] ""
## [31] ""
## [32] ""
## [33] ""
## [34] ""
## [35] ""
## [36] ""
## [37] "177,29,162,79,90,250,137,113,242,115,49,253,140,196,233,174,104"
## [38] "104,37,50,49,104,89,213,51,220,101,39,87,94,109,48,168,235,187,225"
## [39] ""
## [40] ""
## [41] "243,50,121,98,95,7,237,105,244,69,132,249,94,79,9,170,235,11"
## [42] "51,190,33,181,255,241,151,186,124,196,1,142,117,84,213,249,168"
## [43] "60,209,185,249,68,224,124,78,101,194,26,107,168,75,53,1,27,55,29,175"
## [44] ""
## [45] ""
## [46] "49,251,241,176,189,187,166,43,235,144,137,5,93,175,106,193,198,146,48"
## [47] ""
## [48] ""
## [49] "193,24,159,106,198,206,247,55,221,106,131,198,34,105,169,231,88,27,238,51,14"
## [50] "161,156,9,65,198,255,245,191,174,63,155,146,13,95,228,100,132,45,49"
## [51] "109,86,70,169,200,112,237,69,168,97,239,188,150,208,225,190,128,252,142,224"
##
## $sequences
## [1] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [2] "GGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [3] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [4] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [5] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [6] ""
## [7] ""
## [8] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGA"
## [9] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGA"
## [10] ""
## [11] ""
## [12] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [13] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGA"
## [14] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGCGGA"
## [15] ""
## [16] ""
## [17] ""
## [18] ""
## [19] ""
## [20] ""
## [21] ""
## [22] ""
## [23] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [24] ""
## [25] ""
## [26] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [27] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [28] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [29] ""
## [30] ""
## [31] ""
## [32] ""
## [33] ""
## [34] ""
## [35] ""
## [36] ""
## [37] "GGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [38] "GGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [39] ""
## [40] ""
## [41] "GGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [42] "GGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGA"
## [43] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGCGGCGGA"
## [44] ""
## [45] ""
## [46] "GGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [47] ""
## [48] ""
## [49] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [50] "GGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGCGGA"
## [51] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGCGGCGGA"
##
## $lengths
## [1] 102 93 87 81 63 0 0 69 63 0 0 87 84 81 0 0 0 0 0
## [20] 0 0 0 93 0 0 90 87 84 0 0 0 0 0 0 0 0 96 96
## [39] 0 0 93 90 87 0 0 96 0 0 96 90 81
This returns a 4-item list, where each item in the list is a vector of
either modification locations, probabilities, sequences, or sequence
lengths. The modification locations are the indices (starting from 1)
along each read at which modification was assessed, while the
probabilities are 8-bit integers giving the probability of modification
from 0 to 255. This is explained in more detail in the introduction to
example_many_sequences
section.
To use hydroxymethylation instead of methylation, we can simply change the colnames we read from:
## Extract locations, probabilities, and lengths
hydroxymethylation_data_for_visualisation <- extract_and_sort_methylation(
example_many_sequences,
locations_colname = "hydroxymethylation_locations",
probabilities_colname = "hydroxymethylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = c("family" = 8, "individual" = 2),
sort_by = "sequence_length",
desc_sort = TRUE
)
hydroxymethylation_data_for_visualisation## $locations
## [1] "3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84,87,96,99"
## [2] "3,6,9,12,15,18,27,30,33,42,45,48,57,60,63,72,75,78,87,90"
## [3] "3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84"
## [4] "3,6,9,12,15,18,21,24,27,30,33,36,45,48,51,60,63,66,75,78"
## [5] "3,6,9,12,15,18,21,24,27,30,33,42,45,48,57,60"
## [6] ""
## [7] ""
## [8] "3,6,9,12,15,18,21,24,27,30,33,36,48,51,63,66"
## [9] "3,6,9,12,15,18,21,24,27,30,42,45,57,60"
## [10] ""
## [11] ""
## [12] "3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,72,81,84"
## [13] "3,6,9,12,15,18,21,24,27,36,39,42,51,54,57,66,69,78,81"
## [14] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,54,57,60,69,72,75,78"
## [15] ""
## [16] ""
## [17] ""
## [18] ""
## [19] ""
## [20] ""
## [21] ""
## [22] ""
## [23] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,87,90"
## [24] ""
## [25] ""
## [26] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,84,87"
## [27] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,81,84"
## [28] "3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,78,81"
## [29] ""
## [30] ""
## [31] ""
## [32] ""
## [33] ""
## [34] ""
## [35] ""
## [36] ""
## [37] "3,6,9,18,21,30,33,42,45,54,57,66,69,78,81,90,93"
## [38] "3,6,9,12,15,18,21,30,33,42,45,54,57,66,69,78,81,90,93"
## [39] ""
## [40] ""
## [41] "3,6,9,12,15,18,27,30,39,42,51,54,63,66,75,78,87,90"
## [42] "3,6,9,12,15,18,27,30,39,42,51,54,63,66,75,78,87"
## [43] "3,6,9,12,15,18,21,24,27,30,39,42,51,54,63,66,75,78,81,84"
## [44] ""
## [45] ""
## [46] "3,6,9,12,15,18,21,30,33,42,45,54,57,66,69,78,81,90,93"
## [47] ""
## [48] ""
## [49] "3,6,9,12,15,18,21,24,27,30,33,42,45,54,57,66,69,78,81,90,93"
## [50] "3,6,9,12,15,18,21,24,33,36,45,48,57,60,69,72,81,84,87"
## [51] "3,6,9,12,15,18,21,24,27,30,33,36,45,48,57,60,69,72,75,78"
##
## $probabilities
## [1] "26,60,61,60,30,59,2,46,57,64,54,63,52,18,53,34,52,50,39,46,55,54,34"
## [2] "57,18,64,31,63,40,23,61,55,34,23,35,23,30,29,24,64,53,7,54"
## [3] "40,63,58,55,60,56,64,56,64,47,46,17,55,52,64,33,63,64,47,37"
## [4] "33,29,10,55,3,46,53,54,64,12,63,27,24,4,43,21,64,60,17,55"
## [5] "10,44,39,64,20,36,11,63,50,54,64,38,46,41,49,2"
## [6] ""
## [7] ""
## [8] "27,44,20,13,51,28,41,48,19,1,14,64,52,48,64,64"
## [9] "49,9,63,52,41,30,56,33,29,63,9,52,23,12"
## [10] ""
## [11] ""
## [12] "55,10,59,28,62,20,64,21,62,59,29,64,4,56,64,59,60,49,63,5"
## [13] "80,43,103,71,21,112,47,126,21,40,80,35,142,1,238,1,79,111,20"
## [14] "62,63,45,19,32,46,3,61,0,159,42,80,46,84,86,52,8,92,102,4,138,20"
## [15] ""
## [16] ""
## [17] ""
## [18] ""
## [19] ""
## [20] ""
## [21] ""
## [22] ""
## [23] "68,1,220,4,42,36,35,57,3,90,56,79,92,19,93,36,130,47,82,1,109,104,58,11,83,10,86,49"
## [24] ""
## [25] ""
## [26] "3,123,22,121,19,198,3,23,95,102,45,55,54,9,51,53,135,39,83,22,32,72,98,5,184,24,38"
## [27] "17,3,130,28,84,5,50,95,55,112,49,67,7,106,67,0,72,21,209,3,112,60,28,6,188,4"
## [28] "93,18,125,104,6,44,74,17,25,136,42,66,26,88,129,5,89,114,14,133,40,1,145,82,49"
## [29] ""
## [30] ""
## [31] ""
## [32] ""
## [33] ""
## [34] ""
## [35] ""
## [36] ""
## [37] "59,157,11,112,51,2,116,77,6,133,93,0,114,32,17,74,103"
## [38] "61,89,30,41,29,68,15,170,7,133,86,26,55,54,88,16,13,63,22"
## [39] ""
## [40] ""
## [41] "11,195,26,74,62,93,1,139,5,178,33,3,158,65,76,3,13,225"
## [42] "9,13,165,10,0,10,104,65,78,43,124,87,0,95,19,2,73"
## [43] "191,30,16,5,136,30,35,156,75,19,90,112,9,76,133,75,47,0,24,17"
## [44] ""
## [45] ""
## [46] "24,3,3,78,63,47,66,155,13,19,109,141,87,2,55,43,24,83,161"
## [47] ""
## [48] ""
## [49] "36,44,73,14,35,20,6,162,33,32,108,24,113,116,11,10,111,207,6,21,225"
## [50] "52,87,155,117,2,0,3,50,81,184,75,74,60,97,15,8,46,188,81"
## [51] "29,9,79,29,15,95,14,82,81,43,11,25,98,35,18,53,112,2,57,31"
##
## $sequences
## [1] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [2] "GGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [3] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [4] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [5] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [6] ""
## [7] ""
## [8] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGA"
## [9] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGAGGAGGAGGCGGCGGA"
## [10] ""
## [11] ""
## [12] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGA"
## [13] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGA"
## [14] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGCGGAGGAGGCGGCGGCGGCGGA"
## [15] ""
## [16] ""
## [17] ""
## [18] ""
## [19] ""
## [20] ""
## [21] ""
## [22] ""
## [23] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [24] ""
## [25] ""
## [26] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [27] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [28] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGA"
## [29] ""
## [30] ""
## [31] ""
## [32] ""
## [33] ""
## [34] ""
## [35] ""
## [36] ""
## [37] "GGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [38] "GGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [39] ""
## [40] ""
## [41] "GGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [42] "GGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGA"
## [43] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGCGGCGGA"
## [44] ""
## [45] ""
## [46] "GGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [47] ""
## [48] ""
## [49] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGA"
## [50] "GGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGAGGAGGCGGCGGCGGA"
## [51] "GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGTGGTGGCGGCGGCGGCGGA"
##
## $lengths
## [1] 102 93 87 81 63 0 0 69 63 0 0 87 84 81 0 0 0 0 0
## [20] 0 0 0 93 0 0 90 87 84 0 0 0 0 0 0 0 0 96 96
## [39] 0 0 93 90 87 0 0 96 0 0 96 90 81
The hydroxymethylation locations are the same as the methylation
locations (as they have both been assessed at all CpG sites), but the
probabilities are different. This should work for any modification type
in the MM and ML tags, though it has only been tested for C+m? CG
methylation and C+h? CG hydroxymethylation.
This list of locations, probabilities, and sequences can then be used as
input for visualise_methylation(). (Note: pre-v1.0.0 versions of
ggDNAvis used sequence lengths instead of sequences as the third
argument, but this has been changed as inputting sequences allows
calculation of sequence lengths, while also enabling sequence
visualisation).
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_01.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "modification_01.png"))Here all the modification-assessed bases (Cs of CG dinucleotides) are coloured blue for low methylation probability and red for high methylation probability and linearly interpolated for intermediate probabilities. Non-modification-assessed bases are coloured grey, and the background is white.
ggDNAvis also contains a function for making a scalebar for the
methylation probabilities: visualise_methylation_colour_scale().
Unlike the main visualise_ functions, this one will work at any scale
and aspect resolution, so it always returns a ggplot object that can be
exported manually via ggsave().
## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(
axis_location = "bottom",
axis_title = "Methylation probability"
)
## Write png from object
ggsave(paste0(output_location, "modification_01_scalebar.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_01_scalebar.png"))(Note that sometimes vertical white lines can appear in the scalebar,
depending on the exact gradient precision, export dimensions, and dpi.
If this happens, changing the precision argument very slightly usually
fixes it.)
extract_and_sort_methylation() is customisable in all the same ways as
extract_and_sort_sequences(), as discussed in detail in the many
sequences arrangement
customisation section. This
section will provide a brief reminder, but follow that link for a full
explanation.
extract_and_sort_methylation() arguments:
modification_data: The data to be processedlocations_colname: The column locations should be extracted from.probabilities_colname: The column probabilities should be extracted from.sequences_colname: The column sequences should be extracted from.lengths_colname: The column sequence lengths should be extracted from. All four of these just callextract_and_sort_sequences()to extract these columns, so they can technically be used to extract any three columns regardless of what they contain. However, if you are trying to extract and sort a non-DNA-information column, it would probably be more sensible to do that directly viaextract_and_sort_sequences().grouping_levels: How the data should be grouped. This is a named numerical vector stating which variables/columns should be used to group the data, and how many lines should be left between groups at each level. For example, the defaultc("family" = 8, "individual" = 2)means the top-level grouping is done by categories in the"family"column and there are 8 blank lines between each family, and the second-level grouping is done by the"individual"column and there are 2 blank lines between individuals within the same family. This is implemented recursively, so any number of grouping variables can be used (or this can be set toNAto turn off grouping entirely).sort_by: The name of the column used to sort sequences within the lowest-level groups. This is generally the sequence length (but doesn’t have to be).desc_sort: Whether the sequences should be sorted by thesort_byvariable descending (desc_sort = TRUE) or (desc_sort = FALSE).
A single example of how the arrangement might be customised:
## Extract information to list of character vectors
methylation_data_for_visualisation <- extract_and_sort_methylation(
example_many_sequences,
locations_colname = "methylation_locations",
probabilities_colname = "methylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = c("individual" = 3),
sort_by = "sequence_length",
desc_sort = FALSE
)
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_02.png"),
return = FALSE
)
## View image
view_image(paste0(display_location, "modification_02.png"))Here there is no grouping by family, 3 blank lines between each participant, and sequences are sorted in ascending length order within each participant.
Index annotations for visualise_methylation() work identically to
visualise_many_sequences(), as explained in index annotation
customisation for
visualise_many_sequences().
Briefly:
index_annotation_linescontrols which lines receive annotationsindex_annotation_intervalcontrols how frequently along each line index annotations are drawnindex_annotation_full_linecontrols whether annotations go to the end of the image or the end of each sequenceindex_annotations_abovecontrols whether annotations (and the blank lines they are drawn in) go above or below each annotated lineindex_annotation_vertical_positioncontrols how far above each annotated line numbers are drawnindex_annotation_colourcontrols the colour of the numbersindex_annotation_sizecontrols the size of the numbersindex_annotation_always_first_baseandindex_annotation_always_last_basecontrol whether the first and last bases are always annotated even if they fall outside the annotation interval.
For example:
## Extract information to list of character vectors using all default settings
methylation_data_for_visualisation <- extract_and_sort_methylation(example_many_sequences)
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_03.png"),
return = FALSE,
index_annotation_lines = c(14, 28, 51),
index_annotations_above = FALSE,
index_annotation_interval = 3,
index_annotation_full_line = FALSE,
index_annotation_always_first_base = TRUE,
index_annotation_always_last_base = TRUE,
index_annotation_colour = "purple",
index_annotation_size = 16,
index_annotation_vertical_position = 0.45
)
## View image
view_image(paste0(display_location, "modification_03.png"))visualise_methylation() is unique in that it has several different
options for the text that can be drawn inside the boxes. Like
visualise_single_sequence() and visualise_many_sequences(), the
letter for each base can be drawn inside each corresponding box.
However, there is also an option for drawing the probability of
modification inside each assessed base. Probabilities can be scaled to
any desired range - however, the most common options would be leaving
them as 8-bit integers from 0-255 or transforming to probabilities
between 0 and 1.
In all cases, the appearance of the text can be controlled via
sequence_text_colour and sequence_text_size.
The arguments that control the sequence text are:
-
sequence_text_type: Either"none"(default) to draw the boxes only with no text,"sequence"to draw the base sequence inside the boxes similarly tovisualise_many_sequences(), or"probability"to draw the probability of modification inside each assessed base. Note: if set to"none", all othersequence_text_arguments do nothing. If set to"sequence", thensequence_text_scalingandsequence_text_roundingdo nothing. -
sequence_text_scaling: The transformation to be applied to the probabilities, as a length-2 numeric vector ofc(min, max). Probabilities will be scaled via$\frac{p-min}{max}$ before drawing. Setting this toc(0, 1)means no scaling is applied (subtract zero then divide by one) so the original probabilities are drawn i.e. the 8-bit integers. Setting toc(-0.5, 256)(default) applies$\frac{p+0.5}{256}$ to find the centre of the probability space from$\frac{p}{256}$ to$\frac{p+1}{256}$ represented by each integer$p$ , in order to convert each integer to the corresponding probability. Setting toc(0, 255)is therefore not an accurate transformation to 0-1 probability space and should not be used. -
sequence_text_rounding: The number of decimal places that should be drawn. Defaults to2. If settingsequence_text_scaling = c(0, 1)to draw original integers, this should probably be set to0otherwise it will result in e.g."128.00". -
sequence_text_colour: The colour of the sequence/probability text. -
sequence_text_size: The size of the sequence/probability text.
An example drawing the sequences is:
## Extract information to list of character vectors using all default settings
methylation_data_for_visualisation <- extract_and_sort_methylation(example_many_sequences)
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_04.png"),
return = FALSE,
index_annotation_lines = c(1, 23, 37),
sequence_text_type = "sequence"
)
## View image
view_image(paste0(display_location, "modification_04.png"))The default text size is 16, which is appropriate for sequence (1 character per box) but is generally too large for probabilities (often 3-4 characters per box):
## Default sequence_text_scaling is c(-0.5, 256) to scale integers to 0-1.
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_05.png"),
return = FALSE,
index_annotation_lines = c(1, 23, 37),
sequence_text_type = "probability"
)## Warning: The default sequence_text_size of 16 is likely to be too large for displaying probabilities.
## Consider setting sequence_text_size to a smaller value e.g. 10.
## View image
view_image(paste0(display_location, "modification_05.png"))A more sensible version with integers scaled to 0-1 (which is the default, but we will write the arguments explicitly for clarity) would be:
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_06.png"),
return = FALSE,
index_annotation_lines = c(1, 23, 37),
sequence_text_type = "probability",
sequence_text_scaling = c(-0.5, 256),
sequence_text_rounding = 2,
sequence_text_size = 10,
sequence_text_colour = "white"
)
## View image
view_image(paste0(display_location, "modification_06.png"))If we instead wanted to see the integer scores from the original data we would turn off scaling and rounding:
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_07.png"),
return = FALSE,
index_annotation_lines = c(1, 23, 37),
sequence_text_type = "probability",
sequence_text_scaling = c(0, 1),
sequence_text_rounding = 0,
sequence_text_size = 10,
sequence_text_colour = "white"
)
## View image
view_image(paste0(display_location, "modification_07.png"))Colours in visualise_methylation() are controlled by setting the low
and high end points of the modification colour mapping scale, as well as
the colour to use for non-modification-assessed bases and the
background. As before, margin and resolution are customisable.
One important feature to note is that the box outlines can be controlled
separately for modification-assessed (e.g. C of CpG) and
non-modification assessed bases. The same global outline_colour,
outline_linewidth, and outline_join parameters are available as for
visualise_single_sequence() and visualise_many_sequences(). However,
there are also modified_bases_outline_<parameter> and
other_bases_outline_<parameter> arguments that can be used to override
the global setting, or set to NA to inherit the global setting.
One use of this might be to draw outlines only for modification-assessed
bases (using the default black/3/mitre settings). This could be
accomplished by setting other_bases_outline_linewidth = 0 to disable
outlines for non-modification-assessed bases, while allowing
modification-assessed bases to inherit the global default outlines.
Colour-related arguments:
low_colour: The colour to use at the bottom end of the modification probability scale. Defaults to blue (#0000FF).high_colour: The colour to use at the top end of the modification probability scale. Defaults to red (#FF0000).other_bases_colour: The colour to use for non-modification-assessed bases. Defaults to grey and generally should be fairly neutral (though this is not enforced in any way).background_colour: The colour to use for the background. Defaults to white.index_annotation_colour: The colour to use for index annotations. Defaults to dark red.sequence_text_colour: The colour to use for sequence/probability text. Defaults to black.outline_colour: The colour to use for the box outlines. Defaults to white.modified_bases_outline_colour: The colour to use for the box outlines of modification-assessed bases specifically. Can be set toNA(default), in which case the value fromoutline_colouris used. Ifoutline_colourandmodified_bases_outline_colourare set to different values, the value frommodified_bases_outline_colouris prioritised.other_bases_outline_colour: The colour to use for the box outlines of non-modification-assessed bases specifically. Can be set toNA(default), in which case the value fromoutline_colouris used. Ifoutline_colourandother_bases_outline_colourare set to different values, the value fromother_bases_outline_colouris prioritised.
Layout-related arguments:
margin: The margin around the image in terms of the size of base boxes (e.g. the default value of0.5adds a margin half the size of the base boxes, which is 50 px with the defaultpixels_per_base = 100).outline_linewidth: The thickness of the box outlines. Can be set to0to disable box outlines. Defaults to3.modified_bases_outline_linewidth: The thickness of the box outlines for modification-assessed bases specifically. Can be set toNA(default) to inherit the value fromoutline_linewidth, or0to disable box outlines specifically for modification-assessed bases. Ifoutline_linewidthandmodified_bases_outline_linewidthare set to different values, the value frommodified_bases_outline_linewidthis prioritised.other_bases_outline_linewidth: The thickness of the box outlines for non-modification-assessed bases specifically. Can be set toNA(default) to inherit the value fromoutline_linewidth, or0to disable box outlines specifically for non-modification-assessed bases. Ifoutline_linewidthandother_bases_outline_linewidthare set to different values, the value fromother_bases_outline_linewidthis prioritised.outline_join: Changes how the corners of the box outlines are handled. Must be one of"mitre","bevel", or"round". Defaults to"mitre". It is unlikely that you would ever need to change this.modified_bases_outline_join: How corners are handled for modification-assessed bases only. Can be set toNA(default) to inherit fromoutline_join, otherwise overridesoutline_join.other_bases_outline_join: How corners are handled for non-modification-assessed bases only. Can be set toNA(default) to inherit fromoutline_join, otherwise overridesoutline_join.pixels_per_base: Resolution, as determined by number of pixels in the side length of one DNA base square. Everything else is scaled proportionally. Defaults to100.render_device: The deviceggsaveshould use to render the plot. Defaults toragg::agg_png, not recommended to change. Can be set toNULLto infer device based onfilenameextension.
All colour-type arguments should accept colour, color, or col for
the argument name.
Here is an example with wild colours:
## Extract information to list of character vectors
methylation_data_for_visualisation <- extract_and_sort_methylation(
example_many_sequences,
locations_colname = "methylation_locations",
probabilities_colname = "methylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = c("family" = 6,
"individual" = 2),
sort_by = "sequence_length",
desc_sort = FALSE
)
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_08.png"),
return = FALSE,
margin = 4,
sequence_text_type = "sequence",
sequence_text_colour = "magenta",
index_annotation_colour = "yellow",
low_colour = "#00FF00",
high_colour = "blue",
modified_bases_outline_colour = "purple",
modified_bases_outline_linewidth = 5,
other_bases_colour = "white",
other_bases_outline_colour = "darkgreen",
other_bases_outline_linewidth = 0.5,
background_colour = "red"
)
## View image
view_image(paste0(display_location, "modification_08.png"))## Create scalebar and save to object
## Text colour doesn't have an argument within the function
## but can be modified by adding to the ggplot object like normal
scalebar <- visualise_methylation_colour_scale(
axis_title = "Methylation probability",
low_colour = "green",
high_colour = "#0000FF",
background_colour = "#FF0000",
outline_colour = "darkgreen",
outline_linewidth = 1
) +
theme(axis.title = element_text(colour = "white"),
axis.text = element_text(colour = "white"))
## Write png from object
ggsave(paste0(output_location, "modification_08_scalebar.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_08_scalebar.png"))One way this might be used in practice is for making a graphic in the “lollipop” style where methylated/modified CGs are black and unmodified CGs are white:
## Extract information to list of character vectors
methylation_data_for_visualisation <- extract_and_sort_methylation(
example_many_sequences,
locations_colname = "methylation_locations",
probabilities_colname = "methylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = c("family" = 6,
"individual" = 2),
sort_by = "sequence_length",
desc_sort = FALSE
)
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_09.png"),
return = FALSE,
margin = 0.1,
sequence_text_type = "none",
low_colour = "white",
high_colour = "black",
other_bases_colour = "lightblue1",
other_bases_outline_colour = "grey",
other_bases_outline_linewidth = 1,
background_colour = "white"
)## Warning: If margin is small and outlines are on (outline_linewidth > 0), outlines may be cut off at the edges of the plot. Check if this is happening and consider using a bigger margin.
## Current margin: 0.1
## View image
view_image(paste0(display_location, "modification_09.png"))## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(
axis_title = "Methylation probability",
low_colour = "white",
high_colour = "black",
background_colour = "lightblue1"
)
## Write png from object
ggsave(paste0(output_location, "modification_09_scalebar.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_09_scalebar.png"))A very useful feature in visualise_methylation() is the ability to
“clamp” the scale. This means all probabilities below the low_clamp
value will be set to the low colour, all probabilities above the
high_clamp value will be set to the high colour, and linear colour
interpolation will occur only in between the clamp values.
Clamping arguments:
low_clamp: The probability score at and below which all values will be represented aslow_colour.high_clamp: The probability score at and above which all values will be represented ashigh_colour.
The clamp values need to be on the same scale as the probability input
i.e. 0-255 for standard MM/ML tags from Dorado/Guppy modified
basecalling. It would be possible to input decimal probabilities
e.g. "0.1,0.5,0.9,0.23", in which case the default high clamp of 255
will not be appropriate and must be set to a sensible value ≤ 1.
Here is the lollipop scale but with low_clamp = 127 and
high_clamp = 128 to make all values binary white/black depending on
whether they are below or above the equivalent of 0.5 methylation
probability:
## Extract information to list of character vectors
methylation_data_for_visualisation <- extract_and_sort_methylation(
example_many_sequences,
locations_colname = "methylation_locations",
probabilities_colname = "methylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = c("family" = 6,
"individual" = 2),
sort_by = "sequence_length",
desc_sort = FALSE
)
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_10.png"),
return = FALSE,
margin = 0.1,
sequence_text_type = "none",
low_colour = "white",
low_clamp = 127,
high_colour = "black",
high_clamp = 128,
other_bases_colour = "lightblue1",
other_bases_outline_colour = "grey",
other_bases_outline_linewidth = 1,
background_colour = "white"
)## Warning: If margin is small and outlines are on (outline_linewidth > 0), outlines may be cut off at the edges of the plot. Check if this is happening and consider using a bigger margin.
## Current margin: 0.1
## View image
view_image(paste0(display_location, "modification_10.png"))## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(
axis_title = "Methylation probability",
low_colour = "white",
low_clamp = 127,
high_colour = "black",
high_clamp = 128,
background_colour = "lightblue1"
)
## Write png from object
ggsave(paste0(output_location, "modification_10_scalebar.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_10_scalebar.png"))The clamping arguments do not have to be integers. Clamping is
implemented with pmin() and pmax() and relies on their default
behaviour for pm<in/ax>(vector, clamping_value), which is to clamp to
a fraction when the clamping value is fractional. For example,
pmin(c(1,2,3,4,5), 3.5) produces c(1.0, 2.0, 3.0, 3.5, 3.5) i.e. the
values above 3.5 were clamped down to 3.5. Therefore, clamping with
fractional values will clamp extreme probabilities to said fractional
value, but this is not visible and does not interfere with plotting
logic.
This means one approach is to define clamping values as
proportion*255, as that can be easier than working out which integer
to use. Using the standard blue/red colour scheme with the
hydroxymethylation data but clamping at 30% and 70% probability gives
the following:
## Extract information to list of character vectors
methylation_data_for_visualisation <- extract_and_sort_methylation(
example_many_sequences,
locations_colname = "methylation_locations",
probabilities_colname = "methylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = c("family" = 6,
"individual" = 2),
sort_by = "sequence_length",
desc_sort = FALSE
)
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = methylation_data_for_visualisation$locations,
modification_probabilities = methylation_data_for_visualisation$probabilities,
sequences = methylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_11.png"),
return = FALSE,
sequence_text_type = "none",
low_clamp = 0.3*255,
high_clamp = 0.7*255,
outline_linewidth = 0
)
## View image
view_image(paste0(display_location, "modification_11.png"))## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(
axis_title = "Methylation probability",
low_clamp = 0.3*255,
high_clamp = 0.7*255
)
## Write png from object
ggsave(paste0(output_location, "modification_11_scalebar.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_11_scalebar.png"))The clamping does not need to be symmetrical. One use for this is if the
data is skewed. For example, the methylation scores were randomly
generated from 0 to 255 for each CpG in example_many_sequences,
but the hydroxymethylation scores were generated from 0 to
(255 - methylation score) for each CpG to avoid >100% total
modification probability, so they tend to be lower. Here is the
hydroxymethylation data visualised with clamping at 10% and 50%:
## Extract information to list of character vectors
hydroxymethylation_data_for_visualisation <- extract_and_sort_methylation(
example_many_sequences,
locations_colname = "hydroxymethylation_locations",
probabilities_colname = "hydroxymethylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = c("family" = 6,
"individual" = 2),
sort_by = "sequence_length",
desc_sort = FALSE
)
## Use saved methylation data for visualisation to make image
visualise_methylation(
modification_locations = hydroxymethylation_data_for_visualisation$locations,
modification_probabilities = hydroxymethylation_data_for_visualisation$probabilities,
sequences = hydroxymethylation_data_for_visualisation$sequences,
filename = paste0(output_location, "modification_12.png"),
return = FALSE,
sequence_text_type = "none",
low_clamp = 0.1*255,
high_clamp = 0.5*255,
other_bases_outline_linewidth = 0
)
## View image
view_image(paste0(display_location, "modification_12.png"))## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(
axis_title = "Hydroxymethylation probability",
low_clamp = 0.1*255,
high_clamp = 0.5*255
)
## Write png from object
ggsave(paste0(output_location, "modification_12_scalebar.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_12_scalebar.png"))IMPORTANT: make sure that you provide the scalebar when presenting data, especially if clamping is used, otherwise the colours could be misleading or academically dishonest.
The scalebar produced by visualise_methylation_colour_scale() is, like
the rest of the visualisations, highly customisable. The colours,
clamping, precision, and presence of various plot elements are all
customisable via the following arguments:
Colour arguments:
low_colour: The colour to use at the bottom end of the modification probability scale. Defaults to blue (#0000FF).high_colour: The colour to use at the top end of the modification probability scale. Defaults to red (#FF0000).background_colour: The colour to use for the background. Defaults to white.outline_colour: The colour of the outline around the whole scalebar. Defaults to black.
Clamping arguments:
low_clamp: The probability score at and below which all values will be represented aslow_colour. Defaults to0.high_clamp: The probability score at and above which all values will be represented ashigh_colour. Defaults to255.full_range: Length-2 numeric vector specifying the range of possible probability values. Defaults toc(0, 255)butc(0, 1)would also be sensible depending on the data.precision: How many different shades should be rendered. Larger values give a smoother gradient. Defaults to10^3i.e.1000, which looks smooth to my eyes and isn’t too intensive to calculate. Note that if white lines appear in the output image, this is because of issues aligning the very thin rectangles with the pixel grid and can generally be fixed by very slightly changingprecision.
Layout arguments:
axis_location: Which edge should be labelled. The gradient will always be along this axis (i.e. horizontal gradient for"top"or"bottom", vertical gradient for"left"or"right"). Accepts"top"/"north","bottom"/"south","left"/"west", and"right"/"east"(not case sensitive).axis_title: The desired axis title. Defaults toNULL(no title).do_axis_ticks: Boolean specifying whether ticks and number labels on the gradient axis should be enabled. Defaults toTRUE.outline_linewidth: The width of the outline around the whole scalebar. Can be set to 0 to remove outline. Defaults to 1.
Using all defaults but with lower precision gives the following:
## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(precision = 10)
## Write png from object
ggsave(paste0(output_location, "modification_scalebar_alone_01.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_scalebar_alone_01.png"))Disabling axis ticks with intermediate precision gives the following:
## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(
precision = 50,
do_axis_ticks = FALSE
)
## Write png from object
ggsave(paste0(output_location, "modification_scalebar_alone_02.png"), scalebar, dpi = 300, width = 5.25, height = 1.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_scalebar_alone_02.png"))If ticks are left on, they can be customised with scale_x_continuous()
as per usual for a ggplot. Here is an example of the left side being the
gradient axis i.e. a vertical plot, with ticks every 0.1 instead of
every 0.25.
## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(
high_colour = "green",
low_colour = "yellow",
high_clamp = 0.8,
low_clamp = 0.5,
full_range = c(0,1),
precision = 101,
axis_location = "left",
do_axis_ticks = TRUE,
axis_title = "some kind of title",
outline_colour = "red",
outline_linewidth = 3
) +
scale_x_continuous(breaks = seq(0, 1, 0.1))
## Write png from object
ggsave(paste0(output_location, "modification_scalebar_alone_03.png"), scalebar, dpi = 300, width = 2, height = 5.25, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_scalebar_alone_03.png"))And here is an example of a more sensible scalebar with top text:
## Create scalebar and save to object
scalebar <- visualise_methylation_colour_scale(
low_clamp = 0.1*255,
high_clamp = 0.9*255,
axis_location = "north",
axis_title = "Methylation probability",
outline_linewidth = 0
)
## Write png from object
ggsave(paste0(output_location, "modification_scalebar_alone_04.png"), scalebar, dpi = 300, width = 5.25, height = 2, device = ragg::agg_png)
## View image
view_image(paste0(display_location, "modification_scalebar_alone_04.png"))When merging modification data read from FASTQ, the positional offset when reversing can be changed (as discussed in detail in the reading from modified FASTQ section).
A summary of the sensible offset options (i.e. 0 or 1) copied from that section is as follows:
## Here the stars represent the true biochemical modifications on the reverse strand:
## (occurring at the Cs of CGs in the 5'-3' direction)
##
##
## 5' GGCGGCGGCGGCGGCGGA 3'
## 3' CCGCCGCCGCCGCCGCCT 5'
## * * * * *
## If we take the complementary locations on the forward strand,
## the modification locations correspond to Gs rather than Cs,
## but are in the exact same locations:
##
## o o o o o
## 5' GGCGGCGGCGGCGGCGGA 3'
## 3' CCGCCGCCGCCGCCGCCT 5'
## * * * * *
## If we offset the locations by 1 on the forward strand,
## the modifications are always associated with the C of a CG,
## but the locations are moved slightly:
##
## o o o o o
## 5' GGCGGCGGCGGCGGCGGA 3'
## 3' CCGCCGCCGCCGCCGCCT 5'
## * * * * *
The visualisations thus far in this section have all used offset = 1
so that methylated Cs in CGs on the reverse strand are mapped to Cs of
CGs in the forward strand when reverse complemented, ensuring
consistency with reads that were forward to begin with.
However, there are actually four ways reverse read may be displayed: -
All reads 5’-3’, with reverse reads running the opposite direction to
forward reads (accomplished by not using the
forward_<sequence/locations/probabilities> columns in
extract_and_sort_methylation(), so that the raw unreversed reads are
shown). - Reverse reads flipped to 3’-5’ so that they are complementary
to the forward reads (accomplished by setting
reverse_complement_mode = "reverse_only" and offset = 0 in
merge_methylation_with_metadata()) - Reverse reads
reverse-complemented to the corresponding 5’-3’ so that they match the
forward reads, but leaving modifications in the original locations
i.e. G of the reversed CG dinucleotides (accomplished by setting
reverse_complement_mode = "DNA" and offset = 0 in
merge_methylation_with_metadata()). - Reverse reads
reverse-complemented to the corresponding 5’-3’ so that they match the
forward reads, and offsetting the modification locations by 1 to always
be on the C of CG dinucleotides even after reverse-complementing
(accomplished by setting reverse_complement_mode = "DNA" and
offset = 1 in merge_methylation_with_metadata()).
To illustrate this, we will create a dataset of two reads over the same
region but in opposite directions, and apply each of these four
extraction options. This will also serve to illustrate how ggDNAvis
visualisations can be returned as ggplot objects and further modified:
## Create random methylation probabilities
set.seed(1234)
random_probabilities <- sample(0:255, size = 12, replace = TRUE)
## Set up original dataframe with reads always 5'-3'
location_reversing_example <- data.frame(
read = c("example_f", "example_r"),
sequence = c("GGCGGCGGCGGCGGAGGAGGCGGCGGAGGAA", "TTCCTCCGCCGCCTCCTCCGCCGCCGCCGCC"),
quality = rep("BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB", 2),
sequence_length = rep(31, 2),
modification_types = rep("methylation", 2),
methylation_locations = c("3,6,9,12,21,24", "7,10,19,22,25,28"),
methylation_probabilities = c(vector_to_string(random_probabilities[1:6]), vector_to_string(random_probabilities[7:12]))
)
## Set up metadata
location_reversing_metadata <- data.frame(
read = c("example_f", "example_r"),
direction = c("forward", "reverse")
)
## Create new dataframes with various reversal settings and save all to list
## Use c(list(original_dataframe), new_list) to make list of original then the three new ones
offsets <- c(0, 0, 1)
modes <- c("reverse_only", "DNA", "DNA")
dataframes <- c(list(location_reversing_example), lapply(seq_along(offsets), function(i) {
reversed_data <- merge_methylation_with_metadata(
location_reversing_example,
location_reversing_metadata,
reversed_location_offset = offsets[i],
reverse_complement_mode = modes[i]
)
## Overwrite "sequence" with "forward_sequence" etc in the returned dataframe
## This means "sequence" will hold the original sequences for the original dataframe,
## but hold the reversed/forwardified sequences for the following three dataframes
reversed_data$sequence = reversed_data$forward_sequence
reversed_data$methylation_locations = reversed_data$forward_methylation_locations
reversed_data$methylation_probabilities = reversed_data$forward_methylation_probabilities
return(reversed_data)
}))
## Extract locations/probabilities/sequences vectors from each dataframe
## Because of the overwriting at the previous step, "sequence", "modification_locations" etc
## hold the original values for the first (unmodified) dataset, but the forward-ified versions
## for the three later datasets
vectors_for_plotting <- lapply(dataframes, function(x) {
extract_methylation_from_dataframe(
x,
locations_colname = "methylation_locations",
probabilities_colname = "methylation_probabilities",
sequences_colname = "sequence",
lengths_colname = "sequence_length",
grouping_levels = NA,
sort_by = NA
)
})
## Merge vectors across dataframes, with padding in between to visually separate the examples
blanks <- 3
input <- lapply(c("locations", "probabilities", "sequences"), function(x) {
lapply(vectors_for_plotting, function(y) c(y[[x]], rep("", blanks))) %>%
unlist() %>%
head(-blanks) %>%
c("", .)
})
## Calculate the tile width and height that we will end up with
lines_to_annotate <- 0:3*blanks + 1:4*2
margin = 0.5
k <- max(nchar(input[[3]]))
n <- length(input[[3]]) + length(lines_to_annotate)
## Create dataframe for titles
titles <- data.frame(
text = c("(a) Original sequences, both 5'-3' (e.g. original reads):",
"(b) Reversed to be 3'-5', offset 0:",
"(c) Reverse-complemented to 5'-3' of other strand, offset 0:",
"(d) Reverse-complemented to 5'-3' of other strand, offset 1:"),
lines = lines_to_annotate - 1,
x = 0
)
titles$y = 1 - (titles$lines - 0.66) / length(input[[1]])
## Create dataframe for 1 extra tile on each edge
## and for 5' and 3' direction indicators
lines_for_tiles <- sort(
rep(seq_along(lines_to_annotate) + lines_to_annotate - 2, times = 2) +
rep(0:1, each = length(lines_to_annotate)),
decreasing = TRUE
)
directions <- data.frame(
x = rep(c(-0.5, k+0.5) / k, each = length(lines_for_tiles)),
y = rep((lines_for_tiles - 0.5 ) / n, times = 2),
width = 1 / k,
height = 1 / n,
text = c(rep("5'", 2), "5'", "3'", rep("5'", 4),
rep("3'", 2), "3'", "5'", rep("3'", 4))
)
## Create visualisation
output <- visualise_methylation(
input[[1]],
input[[2]],
input[[3]],
index_annotation_lines = lines_to_annotate,
index_annotation_interval = 6,
other_bases_outline_linewidth = 1,
other_bases_outline_colour = "darkgrey",
sequence_text_type = "sequence",
index_annotation_always_first_base = FALSE,
index_annotation_always_last_base = FALSE,
low_clamp = 255*0.4,
high_clamp = 255*0.6,
margin = margin
) +
## Add titles and 5'/3' directions
geom_tile(data = directions, aes(x = x, y = y, width = width, height = height), fill = alpha("white", 0), linewidth = 0) +
geom_text(data = directions, aes(x = x, y = y, label = text), size = 15, col = "darkred", fontface = "bold") +
geom_text(data = titles, aes(x = x, y = y, label = text), hjust = 0, size = 16)
## Save visualisation
ggsave(
paste0(output_location, "modification_reversing_example.png"),
plot = output,
dpi = 100,
## k is the width in bases of the original visualisation
## We added 2 new squares, and need to account for the margin
width = k + 2 + 2*margin,
## n is the height in bases of the original visualisation
## We didn't add any new lines, but still need to account for the margin
height = n + 2*margin,
device = ragg::agg_png
)
## View visualisation
view_image(paste0(display_location, "modification_reversing_example.png"))visualise_methylation() is identical to visualise_many_sequences()
with respect to geom_raster() versus geom_tile(), so read
visualise_many_sequences() performance.
For visualise_methylation(), geom_raster() is automatically used if:
sequence_text_typeis"none"orsequence_text_sizeis0,index_annotation_linesisNAornumeric(0), orindex_annotation_intervalis0, orindex_annotation_sizeis0, and- either:
outline_linewidthis0,modified_bases_outline_linewidthisNA, andother_bases_outline_linewidthisNA, ormodified_bases_outline_linewidthis0andother_bases_outline_linewidthis0
As ggDNAvis visualisations can be returned as ggplots by setting
return = TRUE, they can be added to and further modified using
standard ggplot processing (e.g. adding new geoms). The modification
reversing example just above is one example of this, but more are shown
in the ggDNAvis manuscript
(Jade & Scotter, 2026) - not reproduced here for copyright safety. The
code to generate all these advanced, composite visualisations is
available in the manuscript/
directory
of the source code repo.
The general principles of advanced usage are:
-
Visualisations can be returned using
return = TRUErather than being directly exported viafilename = "myfile.png". -
Additional layers such as text markup can be added in typical ggplot fashion, e.g. by making a new dataframe with text labels and locations (bearing in mind that ggDNAvis visualisations occupy a square from cartesian coordinates 0,0 to 1,1).
-
To export the images with the correct aspect ratio, you will need to calculate the appropriate dimensions. My approach is generally to count the width and height in bases (e.g.
width = max(nchar(sequences))andheight = length(sequences), though bear in mind that index annotations add additional lines e.g. might needheight = length(sequences) + length(index_annotation_lines)), then set those as the width and height in inches inggsave()while settingdpi = pixels_per_base. -
Composite/multi-panel visualisations can be made by merging ggplot objects using
patchworkorcowplotpackages, or by overlaying exported PNGs using themagickpackage.
Harrower, M., & Brewer, C. A. (2003). ColorBrewer.org: An Online Tool for Selecting Colour Schemes for Maps. The Cartographic Journal, 40(1), 27–37. https://doi.org/10.1179/000870403235002042
Sone, J., Mitsuhashi, S., Fujita, A., Mizuguchi, T., Hamanaka, K., Mori, K., Koike, H., Hashiguchi, A., Takashima, H., Sugiyama, H., Kohno, Y., Takiyama, Y., Maeda, K., Doi, H., Koyano, S., Takeuchi, H., Kawamoto, M., Kohara, N., Ando, T., … Sobue, G. (2019). Long-read sequencing identifies GGC repeat expansions in NOTCH2NLC associated with neuronal intranuclear inclusion disease. Nature Genetics, 51(8), 1215–1221. https://doi.org/10.1038/s41588-019-0459-y




































































