Wrapper for viRust-locator, a Rust API for simplied LANL HIV Locator tool.
bundle add virust-locator-rubyIf bundler is not being used to manage dependencies, install the gem by executing:
gem install virust-locator-rubyrequire 'virust_locator'
VirustLocator::Locator.exec("GAAAGCATAGTAATATGGGGAAAGACTCCTAAA")=>
"3681\t3713\t100\tfalse\tGAAAGCATAGTAATATGGGGAAAGACTCCTAAA\tGAAAGCATAGTAATATGGGGAAAGACTCCTAAA"
More options for virust-locator
Usage: virust-locator [OPTIONS] --query
Options:
-q, --query Query sequence
-r, --reference Reference genome, either HXB2 or SIVmm239 [default: HXB2]
-t, --type-query <TYPE_QUERY> Type of query, either nt or aa [default: nt]
-a, --algorithm algorithm for locator, 1 is accurate but slower, 2 is fast but less accurate, suitable for smaller query sequences [default: 1]
-h, --help Print help
-V, --version Print version
-
Fixed a bug for displaying the aligned sequences.
-
Now allow multiple sequences to be run at one time. When running multiple sequences in one query (seperate each with [whitespace]), return object is the locator results one line per query.
-
Fixed a bug for showing the aligned sequences.
-
Fixed a bug that slowed down the performance.
Bug reports and pull requests are welcome on GitHub at https://github.com/[USERNAME]/virust-locator-ruby. This project is intended to be a safe, welcoming space for collaboration, and contributors are expected to adhere to the code of conduct.
The gem is available as open source under the terms of the MIT License.
Everyone interacting in the Virust::Locator::Ruby project's codebases, issue trackers, chat rooms and mailing lists is expected to follow the code of conduct.